EMAIL THIS PAGE TO A FRIEND

OSBPL11

oxysterol binding protein-like 11

161 Gene Product Result for
Synonyms: ORP-11 ORP11 OSBP12 TCCCIA00292
UniProtKB ID: Q9BXB4, A8K9I7
Gene ID:
Human(114885) Summary: This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. [provided by RefSeq, Jul 2008]
Mouse(106326) oxysterol binding protein-like 11
Rat(303888) oxysterol binding protein-like 11
Zebrafish(560514) oxysterol binding protein-like 11
cow(538576) oxysterol binding protein-like 11
Horse(100060459) oxysterol binding protein-like 11
domestic cat(101096664) oxysterol binding protein-like 11
dog(478596) oxysterol binding protein-like 11
chicken(424262) oxysterol binding protein-like 11
sheep(101117718) oxysterol binding protein-like 11
Domestic Rabbit(100344168) oxysterol binding protein-like 11
naked mole-rat(101726055) oxysterol binding protein-like 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022776 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022776 Rosetta Predictions human pricing
NM_001107090 Rosetta Predictions rat pricing
NM_176840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187855 predicted 1084
2 SASI_Hs01_00187857 predicted 734
3 SASI_Hs01_00187858 predicted 764
4 SASI_Hs01_00187859 predicted 1028
5 SASI_Hs02_00356068 predicted 1515
6 SASI_Hs02_00356069 predicted 1409
7 SASI_Hs01_00187861 predicted 2568
8 SASI_Hs01_00187862 predicted 2312
9 SASI_Hs01_00187863 predicted 1530
10 SASI_Hs01_00187864 predicted 2246
11 SASI_Hs01_00187856 predicted 1430
12 SASI_Hs01_00187860 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225396 predicted 636
2 SASI_Rn02_00225397 predicted 2033
3 SASI_Rn02_00225398 predicted 1265
4 SASI_Rn02_00225399 predicted 1010
5 SASI_Rn02_00225400 predicted 1373
6 SASI_Rn02_00225401 predicted 2070
7 SASI_Rn02_00225402 predicted 2043
8 SASI_Rn02_00225403 predicted 1813
9 SASI_Rn02_00225404 predicted 1116
10 SASI_Rn02_00225405 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035158 predicted 1550
2 SASI_Mm01_00035159 predicted 973
3 SASI_Mm01_00035160 predicted 2726
4 SASI_Mm01_00035161 predicted 2110
5 SASI_Mm01_00035162 predicted 1663
6 SASI_Mm01_00035163 predicted 2973
7 SASI_Mm02_00346726 predicted 833
8 SASI_Mm01_00035164 predicted 1457
9 SASI_Mm01_00035165 predicted 1862
10 SASI_Mm01_00035166 predicted 3064
11 SASI_Mm01_00035167 predicted 1299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022776
VALIDATED
OSBPL11 MISSION shRNA Bacterial Glycerol Stock
oxysterol binding protein-like 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022776.4-1490s21c1
Sequence:CCGGCCAGGATCTCTTAATGCTCAACTCGAGTTGAGCATTAAGAGATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1928s1c1
Sequence:CCGGCATGTCAATAGGCGTGACAATCTCGAGATTGTCACGCCTATTGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022776.3-636s1c1
Sequence:CCGGGCTGTAATATCACCCAGTGATCTCGAGATCACTGGGTGATATTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1059s1c1
Sequence:CCGGCAGGATCTCTTAATGCTCAAACTCGAGTTTGAGCATTAAGAGATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-826s1c1
Sequence:CCGGCACTTGCATCTAGTAGTAATTCTCGAGAATTACTACTAGATGCAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-2220s1c1
Sequence:CCGGCTTGAGTTCACATATAGCAATCTCGAGATTGCTATATGTGAACTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-567s1c1
Sequence:CCGGCTGTTGGAGTACTTTGTGAATCTCGAGATTCACAAAGTACTCCAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1184s1c1
Sequence:CCGGCGAGTGGTTAGAACCAAAGATCTCGAGATCTTTGGTTCTAACCACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1058s1c1
Sequence:CCGGCCAGGATCTCTTAATGCTCAACTCGAGTTGAGCATTAAGAGATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-3800s1c1
Sequence:CCGGCCTACTTATTATGGTGCTCAACTCGAGTTGAGCACCATAATAAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022776
VALIDATED
OSBPL11 MISSION shRNA shRNA Plasmid DNA
oxysterol binding protein-like 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022776.4-1490s21c1
Sequence:CCGGCCAGGATCTCTTAATGCTCAACTCGAGTTGAGCATTAAGAGATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1928s1c1
Sequence:CCGGCATGTCAATAGGCGTGACAATCTCGAGATTGTCACGCCTATTGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022776.3-636s1c1
Sequence:CCGGGCTGTAATATCACCCAGTGATCTCGAGATCACTGGGTGATATTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1059s1c1
Sequence:CCGGCAGGATCTCTTAATGCTCAAACTCGAGTTTGAGCATTAAGAGATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-826s1c1
Sequence:CCGGCACTTGCATCTAGTAGTAATTCTCGAGAATTACTACTAGATGCAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-2220s1c1
Sequence:CCGGCTTGAGTTCACATATAGCAATCTCGAGATTGCTATATGTGAACTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-567s1c1
Sequence:CCGGCTGTTGGAGTACTTTGTGAATCTCGAGATTCACAAAGTACTCCAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1184s1c1
Sequence:CCGGCGAGTGGTTAGAACCAAAGATCTCGAGATCTTTGGTTCTAACCACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1058s1c1
Sequence:CCGGCCAGGATCTCTTAATGCTCAACTCGAGTTGAGCATTAAGAGATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-3800s1c1
Sequence:CCGGCCTACTTATTATGGTGCTCAACTCGAGTTGAGCACCATAATAAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022776
VALIDATED
OSBPL11 MISSION shRNA Lentiviral Transduction Particles
oxysterol binding protein-like 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022776.4-1490s21c1
Sequence:CCGGCCAGGATCTCTTAATGCTCAACTCGAGTTGAGCATTAAGAGATCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1928s1c1
Sequence:CCGGCATGTCAATAGGCGTGACAATCTCGAGATTGTCACGCCTATTGACATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022776.3-636s1c1
Sequence:CCGGGCTGTAATATCACCCAGTGATCTCGAGATCACTGGGTGATATTACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1059s1c1
Sequence:CCGGCAGGATCTCTTAATGCTCAAACTCGAGTTTGAGCATTAAGAGATCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-826s1c1
Sequence:CCGGCACTTGCATCTAGTAGTAATTCTCGAGAATTACTACTAGATGCAAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-2220s1c1
Sequence:CCGGCTTGAGTTCACATATAGCAATCTCGAGATTGCTATATGTGAACTCAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-567s1c1
Sequence:CCGGCTGTTGGAGTACTTTGTGAATCTCGAGATTCACAAAGTACTCCAACAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1184s1c1
Sequence:CCGGCGAGTGGTTAGAACCAAAGATCTCGAGATCTTTGGTTCTAACCACTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-1058s1c1
Sequence:CCGGCCAGGATCTCTTAATGCTCAACTCGAGTTGAGCATTAAGAGATCCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022776.3-3800s1c1
Sequence:CCGGCCTACTTATTATGGTGCTCAACTCGAGTTGAGCACCATAATAAGTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176840
VALIDATED
OSBPL11 MISSION shRNA Bacterial Glycerol Stock
oxysterol binding protein-like 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-2779s21c1
Sequence:CCGGCTTCGAATCCAGGCGATTATGCTCGAGCATAATCGCCTGGATTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-4307s1c1
Sequence:CCGGGCTCTGAGAAACCGTTCTCTTCTCGAGAAGAGAACGGTTTCTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176840.2-1287s21c1
Sequence:CCGGCGCTGGCATCTAGTGGTAATTCTCGAGAATTACCACTAGATGCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-2030s21c1
Sequence:CCGGGAGGACCGAATGATTCGATTTCTCGAGAAATCGAATCATTCGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-4307s21c1
Sequence:CCGGGCTCTGAGAAACCGTTCTCTTCTCGAGAAGAGAACGGTTTCTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-1553s21c1
Sequence:CCGGGCAACTATGAACTGCTTAAATCTCGAGATTTAAGCAGTTCATAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176840.2-2388s1c1
Sequence:CCGGGCATGTCAATAGGTGTGACAACTCGAGTTGTCACACCTATTGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-1287s1c1
Sequence:CCGGCGCTGGCATCTAGTGGTAATTCTCGAGAATTACCACTAGATGCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-1553s1c1
Sequence:CCGGGCAACTATGAACTGCTTAAATCTCGAGATTTAAGCAGTTCATAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-2030s1c1
Sequence:CCGGGAGGACCGAATGATTCGATTTCTCGAGAAATCGAATCATTCGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176840
VALIDATED
OSBPL11 MISSION shRNA shRNA Plasmid DNA
oxysterol binding protein-like 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-2779s21c1
Sequence:CCGGCTTCGAATCCAGGCGATTATGCTCGAGCATAATCGCCTGGATTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-4307s1c1
Sequence:CCGGGCTCTGAGAAACCGTTCTCTTCTCGAGAAGAGAACGGTTTCTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176840.2-1287s21c1
Sequence:CCGGCGCTGGCATCTAGTGGTAATTCTCGAGAATTACCACTAGATGCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-2030s21c1
Sequence:CCGGGAGGACCGAATGATTCGATTTCTCGAGAAATCGAATCATTCGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-4307s21c1
Sequence:CCGGGCTCTGAGAAACCGTTCTCTTCTCGAGAAGAGAACGGTTTCTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-1553s21c1
Sequence:CCGGGCAACTATGAACTGCTTAAATCTCGAGATTTAAGCAGTTCATAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176840.2-2388s1c1
Sequence:CCGGGCATGTCAATAGGTGTGACAACTCGAGTTGTCACACCTATTGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-1287s1c1
Sequence:CCGGCGCTGGCATCTAGTGGTAATTCTCGAGAATTACCACTAGATGCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-1553s1c1
Sequence:CCGGGCAACTATGAACTGCTTAAATCTCGAGATTTAAGCAGTTCATAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-2030s1c1
Sequence:CCGGGAGGACCGAATGATTCGATTTCTCGAGAAATCGAATCATTCGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176840
VALIDATED
OSBPL11 MISSION shRNA Lentiviral Transduction Particles
oxysterol binding protein-like 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-2779s21c1
Sequence:CCGGCTTCGAATCCAGGCGATTATGCTCGAGCATAATCGCCTGGATTCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-4307s1c1
Sequence:CCGGGCTCTGAGAAACCGTTCTCTTCTCGAGAAGAGAACGGTTTCTCAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176840.2-1287s21c1
Sequence:CCGGCGCTGGCATCTAGTGGTAATTCTCGAGAATTACCACTAGATGCCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-2030s21c1
Sequence:CCGGGAGGACCGAATGATTCGATTTCTCGAGAAATCGAATCATTCGGTCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-4307s21c1
Sequence:CCGGGCTCTGAGAAACCGTTCTCTTCTCGAGAAGAGAACGGTTTCTCAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176840.2-1553s21c1
Sequence:CCGGGCAACTATGAACTGCTTAAATCTCGAGATTTAAGCAGTTCATAGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176840.2-2388s1c1
Sequence:CCGGGCATGTCAATAGGTGTGACAACTCGAGTTGTCACACCTATTGACATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-1287s1c1
Sequence:CCGGCGCTGGCATCTAGTGGTAATTCTCGAGAATTACCACTAGATGCCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-1553s1c1
Sequence:CCGGGCAACTATGAACTGCTTAAATCTCGAGATTTAAGCAGTTCATAGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176840.2-2030s1c1
Sequence:CCGGGAGGACCGAATGATTCGATTTCTCGAGAAATCGAATCATTCGGTCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)