EMAIL THIS PAGE TO A FRIEND

OSBPL1A

oxysterol binding protein-like 1A

106 Gene Product Result for
Synonyms: ORP-1 ORP1 OSBPL1B
UniProtKB ID: Q9BXW6, B7Z7D3, Q9BZF5, Q9NW87
Gene ID:
Human(114876) Summary: This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms. [provided by RefSeq, Jul 2008]
Mouse(64291) oxysterol binding protein-like 1A
Rat(259221) oxysterol binding protein-like 1A
domestic guinea pig(100717854) oxysterol binding protein-like 1A
naked mole-rat(101708321) oxysterol binding protein-like 1A
Domestic Rabbit(100356707) oxysterol binding protein-like 1A
Goat(100861010) oxysterol binding protein-like 1A
sheep(101118838) oxysterol binding protein-like 1A
Zebrafish(565503) oxysterol binding protein-like 1A
cow(616555) oxysterol binding protein-like 1A
cow(100336844) oxysterol binding protein-like 1A
domestic cat(101097926) oxysterol binding protein-like 1A
dog(480761) oxysterol binding protein-like 1A
chicken(421079) oxysterol binding protein-like 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018030 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018030 Rosetta Predictions human pricing
NM_080597 Rosetta Predictions human pricing
NM_133268 Rosetta Predictions human pricing
NM_172023 Rosetta Predictions rat pricing
NM_207530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030947 predicted 1325
2 SASI_Hs02_00351133 predicted 1251
3 SASI_Hs02_00351134 predicted 1138
4 SASI_Hs02_00351135 predicted 1423
5 SASI_Hs02_00351136 predicted 1295
6 SASI_Hs01_00030945 predicted 1478
7 SASI_Hs02_00351137 predicted 928
8 SASI_Hs02_00351138 predicted 1458
9 SASI_Hs02_00351139 predicted 1296
10 SASI_Hs02_00351140 predicted 1101
11 SASI_Hs01_00030939 predicted 907
12 SASI_Hs01_00030940 predicted 909
13 SASI_Hs01_00030941 predicted 2500
14 SASI_Hs01_00030942 predicted 932
15 SASI_Hs01_00030943 predicted 910
16 SASI_Hs01_00030944 predicted 903
17 SASI_Hs01_00030946 predicted 924
18 SASI_Hs01_00030948 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362324 predicted 2164
2 SASI_Hs02_00362325 predicted 2095
3 SASI_Hs02_00362326 predicted 1677
4 SASI_Hs02_00362327 predicted 1978
5 SASI_Hs02_00362328 predicted 2265
6 SASI_Hs02_00362329 predicted 2143
7 SASI_Hs02_00362330 predicted 2321
8 SASI_Hs02_00362331 predicted 1776
9 SASI_Hs02_00362332 predicted 2309
10 SASI_Hs02_00362333 predicted 2139
11 SASI_Hs01_00213868 predicted 1755
12 SASI_Hs01_00213869 predicted 1675
13 SASI_Hs01_00213870 predicted 1746
14 SASI_Hs01_00213871 predicted 3346
15 SASI_Hs01_00213872 predicted 1778
16 SASI_Hs01_00213873 predicted 1755
17 SASI_Hs01_00213874 predicted 1749
18 SASI_Hs01_00213875 predicted 1769
19 SASI_Hs01_00213876 predicted 1401
20 SASI_Hs01_00213877 predicted 2650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019102 predicted 1751
2 SASI_Hs01_00019103 predicted 1671
3 SASI_Hs01_00019104 predicted 1749
4 SASI_Hs01_00019105 predicted 3274
5 SASI_Hs01_00019106 predicted 1784
6 SASI_Hs01_00019107 predicted 1756
7 SASI_Hs01_00019108 predicted 1742
8 SASI_Hs01_00019109 predicted 1775
9 SASI_Hs01_00019110 predicted 1396
10 SASI_Hs01_00019111 predicted 2577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062283 predicted 2154
2 SASI_Rn02_00269113 predicted 1423
3 SASI_Rn01_00062284 predicted 840
4 SASI_Rn01_00062286 predicted 1335
5 SASI_Rn02_00269114 predicted 1398
6 SASI_Rn02_00269115 predicted 1290
7 SASI_Rn01_00062287 predicted 545
8 SASI_Rn01_00062288 predicted 1167
9 SASI_Rn01_00062289 predicted 1183
10 SASI_Rn01_00062290 predicted 1936
11 SASI_Rn01_00062285 predicted 753
12 SASI_Rn01_00062291 predicted 1018
13 SASI_Rn01_00062292 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352071 predicted 1584
2 SASI_Mm02_00352072 predicted 703
3 SASI_Mm01_00162155 predicted 543
4 SASI_Mm01_00162156 predicted 1703
5 SASI_Mm01_00162157 predicted 905
6 SASI_Mm02_00352073 predicted 1868
7 SASI_Mm01_00162158 predicted 1983
8 SASI_Mm01_00162159 predicted 1031
9 SASI_Mm01_00162161 predicted 2681
10 SASI_Mm01_00162162 predicted 301
11 SASI_Mm01_00162160 predicted 1211
12 SASI_Mm01_00162163 predicted 221
13 SASI_Mm01_00162164 predicted 2029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207530
VALIDATED
OSBPL1A MISSION shRNA Bacterial Glycerol Stock
oxysterol binding protein-like 1A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207530.2-2957s1c1
Sequence:CCGGTCAAGGTGTTTGCTAATCTAACTCGAGTTAGATTAGCAAACACCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207530.2-2191s1c1
Sequence:CCGGCGAAGCATACACATGGACAAACTCGAGTTTGTCCATGTGTATGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207530.2-957s1c1
Sequence:CCGGGCACGGTGAAACCTACAGATACTCGAGTATCTGTAGGTTTCACCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207530.2-1822s1c1
Sequence:CCGGGCAGCGGCTAACTGAATACATCTCGAGATGTATTCAGTTAGCCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207530.2-1790s1c1
Sequence:CCGGCCAGTGATATTTAATGAGCCTCTCGAGAGGCTCATTAAATATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207530.2-2957s21c1
Sequence:CCGGTCAAGGTGTTTGCTAATCTAACTCGAGTTAGATTAGCAAACACCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207530.2-957s21c1
Sequence:CCGGGCACGGTGAAACCTACAGATACTCGAGTATCTGTAGGTTTCACCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207530.2-1822s21c1
Sequence:CCGGGCAGCGGCTAACTGAATACATCTCGAGATGTATTCAGTTAGCCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207530.2-2191s21c1
Sequence:CCGGCGAAGCATACACATGGACAAACTCGAGTTTGTCCATGTGTATGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207530
VALIDATED
OSBPL1A MISSION shRNA shRNA Plasmid DNA
oxysterol binding protein-like 1A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207530.2-2957s1c1
Sequence:CCGGTCAAGGTGTTTGCTAATCTAACTCGAGTTAGATTAGCAAACACCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207530.2-2191s1c1
Sequence:CCGGCGAAGCATACACATGGACAAACTCGAGTTTGTCCATGTGTATGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207530.2-957s1c1
Sequence:CCGGGCACGGTGAAACCTACAGATACTCGAGTATCTGTAGGTTTCACCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207530.2-1822s1c1
Sequence:CCGGGCAGCGGCTAACTGAATACATCTCGAGATGTATTCAGTTAGCCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207530.2-1790s1c1
Sequence:CCGGCCAGTGATATTTAATGAGCCTCTCGAGAGGCTCATTAAATATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207530.2-2957s21c1
Sequence:CCGGTCAAGGTGTTTGCTAATCTAACTCGAGTTAGATTAGCAAACACCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207530.2-957s21c1
Sequence:CCGGGCACGGTGAAACCTACAGATACTCGAGTATCTGTAGGTTTCACCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207530.2-1822s21c1
Sequence:CCGGGCAGCGGCTAACTGAATACATCTCGAGATGTATTCAGTTAGCCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207530.2-2191s21c1
Sequence:CCGGCGAAGCATACACATGGACAAACTCGAGTTTGTCCATGTGTATGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207530
VALIDATED
OSBPL1A MISSION shRNA Lentiviral Transduction Particles
oxysterol binding protein-like 1A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207530.2-2957s1c1
Sequence:CCGGTCAAGGTGTTTGCTAATCTAACTCGAGTTAGATTAGCAAACACCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207530.2-2191s1c1
Sequence:CCGGCGAAGCATACACATGGACAAACTCGAGTTTGTCCATGTGTATGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207530.2-957s1c1
Sequence:CCGGGCACGGTGAAACCTACAGATACTCGAGTATCTGTAGGTTTCACCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207530.2-1822s1c1
Sequence:CCGGGCAGCGGCTAACTGAATACATCTCGAGATGTATTCAGTTAGCCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207530.2-1790s1c1
Sequence:CCGGCCAGTGATATTTAATGAGCCTCTCGAGAGGCTCATTAAATATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207530.2-2957s21c1
Sequence:CCGGTCAAGGTGTTTGCTAATCTAACTCGAGTTAGATTAGCAAACACCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207530.2-957s21c1
Sequence:CCGGGCACGGTGAAACCTACAGATACTCGAGTATCTGTAGGTTTCACCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207530.2-1822s21c1
Sequence:CCGGGCAGCGGCTAACTGAATACATCTCGAGATGTATTCAGTTAGCCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207530.2-2191s21c1
Sequence:CCGGCGAAGCATACACATGGACAAACTCGAGTTTGTCCATGTGTATGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018030
OSBPL1A MISSION shRNA Bacterial Glycerol Stock
oxysterol binding protein-like 1A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-1212s1c1
Sequence:CCGGCTGCTGGGAGAGACTTATGAACTCGAGTTCATAAGTCTCTCCCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-916s1c1
Sequence:CCGGGCATCAAGAAACACAGAACAACTCGAGTTGTTCTGTGTTTCTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-1431s1c1
Sequence:CCGGGAGGCATATACATGGACAAATCTCGAGATTTGTCCATGTATATGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018030.3-3071s1c1
Sequence:CCGGGCAAAGTACCTGTGTACTTAACTCGAGTTAAGTACACAGGTACTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018030.3-1019s1c1
Sequence:CCGGGATCACGATGCCAGTTATATTCTCGAGAATATAACTGGCATCGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-1784s1c1
Sequence:CCGGGCCGGATTCTGAAAGTGTATTCTCGAGAATACACTTTCAGAATCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1301s21c1
Sequence:CCGGATTTCATGCTGAAGGATTAAACTCGAGTTTAATCCTTCAGCATGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018030.3-2581s21c1
Sequence:CCGGGATGTAACCTTTGACATATTTCTCGAGAAATATGTCAAAGGTTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1818s21c1
Sequence:CCGGAGCGTTCTTCTATGGCGAATACTCGAGTATTCGCCATAGAAGAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1018s21c1
Sequence:CCGGAGATCACGATGCCAGTTATATCTCGAGATATAACTGGCATCGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1421s21c1
Sequence:CCGGTGAACACAATGAGGCATATACCTCGAGGTATATGCCTCATTGTGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018030
OSBPL1A MISSION shRNA shRNA Plasmid DNA
oxysterol binding protein-like 1A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-1212s1c1
Sequence:CCGGCTGCTGGGAGAGACTTATGAACTCGAGTTCATAAGTCTCTCCCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-916s1c1
Sequence:CCGGGCATCAAGAAACACAGAACAACTCGAGTTGTTCTGTGTTTCTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-1431s1c1
Sequence:CCGGGAGGCATATACATGGACAAATCTCGAGATTTGTCCATGTATATGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018030.3-3071s1c1
Sequence:CCGGGCAAAGTACCTGTGTACTTAACTCGAGTTAAGTACACAGGTACTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018030.3-1019s1c1
Sequence:CCGGGATCACGATGCCAGTTATATTCTCGAGAATATAACTGGCATCGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-1784s1c1
Sequence:CCGGGCCGGATTCTGAAAGTGTATTCTCGAGAATACACTTTCAGAATCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1301s21c1
Sequence:CCGGATTTCATGCTGAAGGATTAAACTCGAGTTTAATCCTTCAGCATGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018030.3-2581s21c1
Sequence:CCGGGATGTAACCTTTGACATATTTCTCGAGAAATATGTCAAAGGTTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1818s21c1
Sequence:CCGGAGCGTTCTTCTATGGCGAATACTCGAGTATTCGCCATAGAAGAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1018s21c1
Sequence:CCGGAGATCACGATGCCAGTTATATCTCGAGATATAACTGGCATCGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1421s21c1
Sequence:CCGGTGAACACAATGAGGCATATACCTCGAGGTATATGCCTCATTGTGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018030
OSBPL1A MISSION shRNA Lentiviral Transduction Particles
oxysterol binding protein-like 1A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-1212s1c1
Sequence:CCGGCTGCTGGGAGAGACTTATGAACTCGAGTTCATAAGTCTCTCCCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-916s1c1
Sequence:CCGGGCATCAAGAAACACAGAACAACTCGAGTTGTTCTGTGTTTCTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-1431s1c1
Sequence:CCGGGAGGCATATACATGGACAAATCTCGAGATTTGTCCATGTATATGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018030.3-3071s1c1
Sequence:CCGGGCAAAGTACCTGTGTACTTAACTCGAGTTAAGTACACAGGTACTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018030.3-1019s1c1
Sequence:CCGGGATCACGATGCCAGTTATATTCTCGAGAATATAACTGGCATCGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018030.3-1784s1c1
Sequence:CCGGGCCGGATTCTGAAAGTGTATTCTCGAGAATACACTTTCAGAATCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1301s21c1
Sequence:CCGGATTTCATGCTGAAGGATTAAACTCGAGTTTAATCCTTCAGCATGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018030.3-2581s21c1
Sequence:CCGGGATGTAACCTTTGACATATTTCTCGAGAAATATGTCAAAGGTTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1818s21c1
Sequence:CCGGAGCGTTCTTCTATGGCGAATACTCGAGTATTCGCCATAGAAGAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1018s21c1
Sequence:CCGGAGATCACGATGCCAGTTATATCTCGAGATATAACTGGCATCGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018030.3-1421s21c1
Sequence:CCGGTGAACACAATGAGGCATATACCTCGAGGTATATGCCTCATTGTGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)