EMAIL THIS PAGE TO A FRIEND

OSBPL2

oxysterol binding protein-like 2

72 Gene Product Result for
Synonyms: ORP-2 ORP2
UniProtKB ID: Q9H1P3, A8K736, Q6IBT0, Q9BZB1, Q9Y4B8
Gene ID:
Human(9885) Summary: This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This encoded protein contains only the sterol-binding domain. In vitro studies have shown that the encoded protein can bind strongly to phosphatic acid and weakly to phosphatidylinositol 3-phosphate, but cannot bind to 25-hydroxycholesterol. The protein associates with the Golgi apparatus. Transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(228983) oxysterol binding protein-like 2
Rat(296461) oxysterol binding protein-like 2
chicken(419227) oxysterol binding protein-like 2
dog(477283) oxysterol binding protein-like 2
domestic cat(101084184) oxysterol binding protein-like 2
cow(505328) oxysterol binding protein-like 2
Horse(100051127) oxysterol binding protein-like 2
sheep(101112838) oxysterol binding protein-like 2
Domestic Rabbit(100340986) oxysterol binding protein-like 2
naked mole-rat(101700610) oxysterol binding protein-like 2
domestic guinea pig(100712790) oxysterol binding protein-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144498 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014835 Rosetta Predictions human pricing
NM_144498 Rosetta Predictions human pricing
NM_001013079 Rosetta Predictions rat pricing
NM_144500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184402 predicted 650
2 SASI_Hs01_00184403 predicted 1086
3 SASI_Hs01_00184405 predicted 1748
4 SASI_Hs01_00184406 predicted 1273
5 SASI_Hs01_00184407 predicted 640
6 SASI_Hs01_00184408 predicted 630
7 SASI_Hs02_00346392 predicted 1834
8 SASI_Hs01_00184409 predicted 907
9 SASI_Hs01_00184410 predicted 620
10 SASI_Hs01_00184411 predicted 1283
11 SASI_Hs01_00184404 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204988 predicted 691
2 SASI_Hs01_00204989 predicted 1124
3 SASI_Hs01_00204991 predicted 1783
4 SASI_Hs01_00204992 predicted 1310
5 SASI_Hs01_00204993 predicted 668
6 SASI_Hs01_00204994 predicted 668
7 SASI_Hs02_00364322 predicted 1873
8 SASI_Hs01_00204995 predicted 941
9 SASI_Hs01_00204996 predicted 658
10 SASI_Hs01_00204997 predicted 1316
11 SASI_Hs01_00204990 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044938 predicted 1029
2 SASI_Rn01_00044939 predicted 1069
3 SASI_Rn01_00044941 predicted 681
4 SASI_Rn01_00044942 predicted 749
5 SASI_Rn01_00044943 predicted 992
6 SASI_Rn01_00044944 predicted 629
7 SASI_Rn01_00044945 predicted 1221
8 SASI_Rn01_00044946 predicted 1624
9 SASI_Rn01_00044947 predicted 1088
10 SASI_Rn02_00200711 predicted 472
11 SASI_Rn01_00044940 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192092 predicted 975
2 SASI_Mm01_00192093 predicted 441
3 SASI_Mm01_00192094 predicted 1037
4 SASI_Mm01_00192095 predicted 1026
5 SASI_Mm01_00192096 predicted 523
6 SASI_Mm01_00192097 predicted 531
7 SASI_Mm01_00192098 predicted 936
8 SASI_Mm01_00192099 predicted 1040
9 SASI_Mm01_00192100 predicted 931
10 SASI_Mm01_00192101 predicted 1133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144498
OSBPL2 MISSION shRNA Bacterial Glycerol Stock
oxysterol binding protein-like 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144498.1-1600s21c1
Sequence:CCGGGGATTACTTTGAGCGGAATTTCTCGAGAAATTCCGCTCAAAGTAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-1084s1c1
Sequence:CCGGGCTCTTTATGATCTATGGCAACTCGAGTTGCCATAGATCATAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-284s1c1
Sequence:CCGGCAGAAAGTCACGGGAATGATTCTCGAGAATCATTCCCGTGACTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-646s1c1
Sequence:CCGGCGGCAAACCATTTAATCCACTCTCGAGAGTGGATTAAATGGTTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144498.1-2110s1c1
Sequence:CCGGGCCAGGGATTGCCTTCTAAATCTCGAGATTTAGAAGGCAATCCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144498.1-670s21c1
Sequence:CCGGGGGAGAAACGTATGAATTAATCTCGAGATTAATTCATACGTTTCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144498.1-1857s21c1
Sequence:CCGGTGGGATCATCGTCTTCATTAACTCGAGTTAATGAAGACGATGATCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-279s1c1
Sequence:CCGGCAAATCAGAAAGTCACGGGAACTCGAGTTCCCGTGACTTTCTGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144498.1-695s21c1
Sequence:CCGGGAAGATTTAGGATTCAGATTTCTCGAGAAATCTGAATCCTAAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-294s1c1
Sequence:CCGGCGGGAATGATTGACTTAGACACTCGAGTGTCTAAGTCAATCATTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-866s1c1
Sequence:CCGGGAGCTGCTCAAACATAATGAACTCGAGTTCATTATGTTTGAGCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144498
OSBPL2 MISSION shRNA shRNA Plasmid DNA
oxysterol binding protein-like 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144498.1-1600s21c1
Sequence:CCGGGGATTACTTTGAGCGGAATTTCTCGAGAAATTCCGCTCAAAGTAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-1084s1c1
Sequence:CCGGGCTCTTTATGATCTATGGCAACTCGAGTTGCCATAGATCATAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-284s1c1
Sequence:CCGGCAGAAAGTCACGGGAATGATTCTCGAGAATCATTCCCGTGACTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-646s1c1
Sequence:CCGGCGGCAAACCATTTAATCCACTCTCGAGAGTGGATTAAATGGTTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144498.1-2110s1c1
Sequence:CCGGGCCAGGGATTGCCTTCTAAATCTCGAGATTTAGAAGGCAATCCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144498.1-670s21c1
Sequence:CCGGGGGAGAAACGTATGAATTAATCTCGAGATTAATTCATACGTTTCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144498.1-1857s21c1
Sequence:CCGGTGGGATCATCGTCTTCATTAACTCGAGTTAATGAAGACGATGATCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-279s1c1
Sequence:CCGGCAAATCAGAAAGTCACGGGAACTCGAGTTCCCGTGACTTTCTGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144498.1-695s21c1
Sequence:CCGGGAAGATTTAGGATTCAGATTTCTCGAGAAATCTGAATCCTAAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-294s1c1
Sequence:CCGGCGGGAATGATTGACTTAGACACTCGAGTGTCTAAGTCAATCATTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-866s1c1
Sequence:CCGGGAGCTGCTCAAACATAATGAACTCGAGTTCATTATGTTTGAGCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144498
OSBPL2 MISSION shRNA Lentiviral Transduction Particles
oxysterol binding protein-like 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144498.1-1600s21c1
Sequence:CCGGGGATTACTTTGAGCGGAATTTCTCGAGAAATTCCGCTCAAAGTAATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-1084s1c1
Sequence:CCGGGCTCTTTATGATCTATGGCAACTCGAGTTGCCATAGATCATAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-284s1c1
Sequence:CCGGCAGAAAGTCACGGGAATGATTCTCGAGAATCATTCCCGTGACTTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-646s1c1
Sequence:CCGGCGGCAAACCATTTAATCCACTCTCGAGAGTGGATTAAATGGTTTGCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144498.1-2110s1c1
Sequence:CCGGGCCAGGGATTGCCTTCTAAATCTCGAGATTTAGAAGGCAATCCCTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144498.1-670s21c1
Sequence:CCGGGGGAGAAACGTATGAATTAATCTCGAGATTAATTCATACGTTTCTCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144498.1-1857s21c1
Sequence:CCGGTGGGATCATCGTCTTCATTAACTCGAGTTAATGAAGACGATGATCCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-279s1c1
Sequence:CCGGCAAATCAGAAAGTCACGGGAACTCGAGTTCCCGTGACTTTCTGATTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144498.1-695s21c1
Sequence:CCGGGAAGATTTAGGATTCAGATTTCTCGAGAAATCTGAATCCTAAATCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-294s1c1
Sequence:CCGGCGGGAATGATTGACTTAGACACTCGAGTGTCTAAGTCAATCATTCCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144498.1-866s1c1
Sequence:CCGGGAGCTGCTCAAACATAATGAACTCGAGTTCATTATGTTTGAGCAGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144500
VALIDATED
OSBPL2 MISSION shRNA Bacterial Glycerol Stock
oxysterol binding protein-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144500.3-417s21c1
Sequence:CCGGCGACTTCAGTGTGTGGAGTATCTCGAGATACTCCACACACTGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144500.3-936s21c1
Sequence:CCGGGCAGCTATGGATAGAGCAGTACTCGAGTACTGCTCTATCCATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144500.3-1674s21c1
Sequence:CCGGGCAGCCTTGGAATCCTCAAATCTCGAGATTTGAGGATTCCAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144500.3-1083s21c1
Sequence:CCGGGCTCTTTATCATGTATGGCAACTCGAGTTGCCATACATGATAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144500.1-1681s1c1
Sequence:CCGGGCAGCCTTGGAATCCTCAAATCTCGAGATTTGAGGATTCCAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144500.1-424s1c1
Sequence:CCGGCGACTTCAGTGTGTGGAGTATCTCGAGATACTCCACACACTGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144500.1-943s1c1
Sequence:CCGGGCAGCTATGGATAGAGCAGTACTCGAGTACTGCTCTATCCATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144500.1-1090s1c1
Sequence:CCGGGCTCTTTATCATGTATGGCAACTCGAGTTGCCATACATGATAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144500.1-1615s1c1
Sequence:CCGGCGGCCATTACTTTGAGCGTAACTCGAGTTACGCTCAAAGTAATGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144500
VALIDATED
OSBPL2 MISSION shRNA shRNA Plasmid DNA
oxysterol binding protein-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144500.3-417s21c1
Sequence:CCGGCGACTTCAGTGTGTGGAGTATCTCGAGATACTCCACACACTGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144500.3-936s21c1
Sequence:CCGGGCAGCTATGGATAGAGCAGTACTCGAGTACTGCTCTATCCATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144500.3-1674s21c1
Sequence:CCGGGCAGCCTTGGAATCCTCAAATCTCGAGATTTGAGGATTCCAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144500.3-1083s21c1
Sequence:CCGGGCTCTTTATCATGTATGGCAACTCGAGTTGCCATACATGATAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144500.1-1681s1c1
Sequence:CCGGGCAGCCTTGGAATCCTCAAATCTCGAGATTTGAGGATTCCAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144500.1-424s1c1
Sequence:CCGGCGACTTCAGTGTGTGGAGTATCTCGAGATACTCCACACACTGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144500.1-943s1c1
Sequence:CCGGGCAGCTATGGATAGAGCAGTACTCGAGTACTGCTCTATCCATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144500.1-1090s1c1
Sequence:CCGGGCTCTTTATCATGTATGGCAACTCGAGTTGCCATACATGATAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144500.1-1615s1c1
Sequence:CCGGCGGCCATTACTTTGAGCGTAACTCGAGTTACGCTCAAAGTAATGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144500
VALIDATED
OSBPL2 MISSION shRNA Lentiviral Transduction Particles
oxysterol binding protein-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144500.3-417s21c1
Sequence:CCGGCGACTTCAGTGTGTGGAGTATCTCGAGATACTCCACACACTGAAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144500.3-936s21c1
Sequence:CCGGGCAGCTATGGATAGAGCAGTACTCGAGTACTGCTCTATCCATAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144500.3-1674s21c1
Sequence:CCGGGCAGCCTTGGAATCCTCAAATCTCGAGATTTGAGGATTCCAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144500.3-1083s21c1
Sequence:CCGGGCTCTTTATCATGTATGGCAACTCGAGTTGCCATACATGATAAAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144500.1-1681s1c1
Sequence:CCGGGCAGCCTTGGAATCCTCAAATCTCGAGATTTGAGGATTCCAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144500.1-424s1c1
Sequence:CCGGCGACTTCAGTGTGTGGAGTATCTCGAGATACTCCACACACTGAAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144500.1-943s1c1
Sequence:CCGGGCAGCTATGGATAGAGCAGTACTCGAGTACTGCTCTATCCATAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144500.1-1090s1c1
Sequence:CCGGGCTCTTTATCATGTATGGCAACTCGAGTTGCCATACATGATAAAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144500.1-1615s1c1
Sequence:CCGGCGGCCATTACTTTGAGCGTAACTCGAGTTACGCTCAAAGTAATGGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)