EMAIL THIS PAGE TO A FRIEND

OSCAR

osteoclast associated, immunoglobulin-like receptor

126 Gene Product Result for
Synonyms: PIGR3 PIgR-3
Gene ID:
Human(126014) Summary: Osteoclasts are multinucleated cells that resorb bone and are essential for bone homeostasis. This gene encodes an osteoclast-associated receptor (OSCAR), which is a member of the leukocyte receptor complex (LRC) protein family that plays critical roles in the regulation of both innate and adaptive immune responses. Different from the other LRC members, OSCAR expression is detected specifically in preosteoclasts or mature osteoclasts. OSCAR may be an important bone-specific regulator of osteoclast differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(232790) osteoclast associated receptor
Rat(292537) osteoclast associated, immunoglobulin-like receptor
dog(484313) osteoclast associated, immunoglobulin-like receptor
cow(100336423) osteoclast associated, immunoglobulin-like receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1620 Human OSCAR ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130771 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130771 Rosetta Predictions human pricing
NM_133168 Rosetta Predictions human pricing
NM_133169 Rosetta Predictions human pricing
NM_206817 Rosetta Predictions human pricing
NM_206818 Rosetta Predictions human pricing
XM_001066538 Rosetta Predictions rat pricing
XM_218174 Rosetta Predictions rat pricing
NM_175632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362790 predicted 371
2 SASI_Hs02_00362791 predicted 459
3 SASI_Hs02_00362792 predicted 406
4 SASI_Hs02_00362793 predicted 496
5 SASI_Hs02_00362794 predicted 399
6 SASI_Hs02_00362795 predicted 363
7 SASI_Hs01_00194293 predicted 728
8 SASI_Hs01_00194294 predicted 874
9 SASI_Hs01_00194295 predicted 105
10 SASI_Hs01_00194296 predicted 644
11 SASI_Hs01_00194297 predicted 187
12 SASI_Hs01_00194298 predicted 644
13 SASI_Hs01_00194299 predicted 153
14 SASI_Hs01_00194300 predicted 653
15 SASI_Hs01_00194301 predicted 107
16 SASI_Hs01_00194302 predicted 129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362919 predicted 320
2 SASI_Hs02_00362920 predicted 416
3 SASI_Hs02_00362921 predicted 364
4 SASI_Hs02_00362922 predicted 447
5 SASI_Hs01_00189785 predicted 351
6 SASI_Hs02_00362923 predicted 314
7 SASI_Hs01_00189778 predicted 681
8 SASI_Hs01_00189779 predicted 831
9 SASI_Hs01_00189780 predicted 601
10 SASI_Hs01_00189781 predicted 131
11 SASI_Hs01_00189782 predicted 601
12 SASI_Hs01_00189783 predicted 609
13 SASI_Hs01_00189784 predicted 858
14 SASI_Hs01_00189786 predicted 252
15 SASI_Hs01_00189787 predicted 176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362924 predicted 356
2 SASI_Hs02_00362925 predicted 445
3 SASI_Hs02_00362926 predicted 395
4 SASI_Hs02_00362927 predicted 478
5 SASI_Hs01_00072599 predicted 392
6 SASI_Hs02_00362928 predicted 345
7 SASI_Hs01_00072590 predicted 715
8 SASI_Hs01_00072591 predicted 861
9 SASI_Hs01_00072592 predicted 101
10 SASI_Hs01_00072593 predicted 636
11 SASI_Hs01_00072594 predicted 175
12 SASI_Hs01_00072595 predicted 641
13 SASI_Hs01_00072596 predicted 637
14 SASI_Hs01_00072597 predicted 105
15 SASI_Hs01_00072598 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202267 predicted 1209
2 SASI_Hs01_00202268 predicted 1360
3 SASI_Hs01_00202269 predicted 111
4 SASI_Hs01_00202270 predicted 616
5 SASI_Hs01_00202271 predicted 1211
6 SASI_Hs01_00202272 predicted 169
7 SASI_Hs01_00202273 predicted 611
8 SASI_Hs01_00202274 predicted 614
9 SASI_Hs01_00202275 predicted 112
10 SASI_Hs01_00202276 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373532 predicted 364
2 SASI_Hs02_00373533 predicted 462
3 SASI_Hs02_00373534 predicted 409
4 SASI_Hs02_00373535 predicted 489
5 SASI_Hs02_00373536 predicted 402
6 SASI_Hs02_00373537 predicted 354
7 SASI_Hs01_00038503 predicted 1243
8 SASI_Hs01_00038504 predicted 1386
9 SASI_Hs02_00373538 predicted 105
10 SASI_Hs01_00038505 predicted 646
11 SASI_Hs01_00038506 predicted 1243
12 SASI_Hs01_00038507 predicted 180
13 SASI_Hs01_00038508 predicted 651
14 SASI_Hs01_00038509 predicted 653
15 SASI_Hs01_00038510 predicted 113
16 SASI_Hs01_00038511 predicted 131
17 SASI_Hs01_00038512 predicted 1412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317873 predicted 345
2 SASI_Rn02_00317874 predicted 521
3 SASI_Rn02_00317875 predicted 529
4 SASI_Rn02_00317876 predicted 342
5 SASI_Rn02_00317877 predicted 519
6 SASI_Rn02_00317878 predicted 414
7 SASI_Rn02_00317879 predicted 410
8 SASI_Rn02_00317880 predicted 311
9 SASI_Rn02_00317881 predicted 246
10 SASI_Rn02_00317882 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377517 predicted 371
2 SASI_Rn02_00377518 predicted 557
3 SASI_Rn02_00377519 predicted 567
4 SASI_Rn02_00377520 predicted 439
5 SASI_Rn02_00377521 predicted 452
6 SASI_Rn02_00377522 predicted 335
7 SASI_Rn02_00377523 predicted 350
8 SASI_Rn02_00377524 predicted 334
9 SASI_Rn02_00377525 predicted 277
10 SASI_Rn02_00377526 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109526 predicted 637
2 SASI_Mm01_00109527 predicted 703
3 SASI_Mm01_00109528 predicted 744
4 SASI_Mm01_00109529 predicted 1336
5 SASI_Mm01_00109530 predicted 519
6 SASI_Mm02_00346562 predicted 1292
7 SASI_Mm01_00109532 predicted 1015
8 SASI_Mm01_00109534 predicted 405
9 SASI_Mm01_00109535 predicted 638
10 SASI_Mm02_00346563 predicted 1319
11 SASI_Mm01_00109531 predicted 306
12 SASI_Mm01_00109533 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130771
OSCAR MISSION shRNA Bacterial Glycerol Stock
osteoclast associated, immunoglobulin-like receptor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130771.3-1089s21c1
Sequence:CCGGGAAGACAGAGGGTTCGAATCCCTCGAGGGATTCGAACCCTCTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130771.3-1141s21c1
Sequence:CCGGCAGCTACAGAAAGGTAGTAGTCTCGAGACTACTACCTTTCTGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130771.3-295s21c1
Sequence:CCGGTTCTCTTCCGGGATGTGTCCTCTCGAGAGGACACATCCCGGAAGAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-104s1c1
Sequence:CCGGGCCTCTGTGTCACACAGACATCTCGAGATGTCTGTGTGACACAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-539s1c1
Sequence:CCGGGCGGAACATGAGCTTCGTGCTCTCGAGAGCACGAAGCTCATGTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-320s1c1
Sequence:CCGGGCTGGCAGAATTCTTTCTGGACTCGAGTCCAGAAAGAATTCTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-126s1c1
Sequence:CCGGACTCCGTCTGTGGCCATTATACTCGAGTATAATGGCCACAGACGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130771
OSCAR MISSION shRNA shRNA Plasmid DNA
osteoclast associated, immunoglobulin-like receptor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130771.3-1089s21c1
Sequence:CCGGGAAGACAGAGGGTTCGAATCCCTCGAGGGATTCGAACCCTCTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130771.3-1141s21c1
Sequence:CCGGCAGCTACAGAAAGGTAGTAGTCTCGAGACTACTACCTTTCTGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130771.3-295s21c1
Sequence:CCGGTTCTCTTCCGGGATGTGTCCTCTCGAGAGGACACATCCCGGAAGAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-104s1c1
Sequence:CCGGGCCTCTGTGTCACACAGACATCTCGAGATGTCTGTGTGACACAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-539s1c1
Sequence:CCGGGCGGAACATGAGCTTCGTGCTCTCGAGAGCACGAAGCTCATGTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-320s1c1
Sequence:CCGGGCTGGCAGAATTCTTTCTGGACTCGAGTCCAGAAAGAATTCTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-126s1c1
Sequence:CCGGACTCCGTCTGTGGCCATTATACTCGAGTATAATGGCCACAGACGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130771
OSCAR MISSION shRNA Lentiviral Transduction Particles
osteoclast associated, immunoglobulin-like receptor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130771.3-1089s21c1
Sequence:CCGGGAAGACAGAGGGTTCGAATCCCTCGAGGGATTCGAACCCTCTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130771.3-1141s21c1
Sequence:CCGGCAGCTACAGAAAGGTAGTAGTCTCGAGACTACTACCTTTCTGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130771.3-295s21c1
Sequence:CCGGTTCTCTTCCGGGATGTGTCCTCTCGAGAGGACACATCCCGGAAGAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-104s1c1
Sequence:CCGGGCCTCTGTGTCACACAGACATCTCGAGATGTCTGTGTGACACAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-539s1c1
Sequence:CCGGGCGGAACATGAGCTTCGTGCTCTCGAGAGCACGAAGCTCATGTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-320s1c1
Sequence:CCGGGCTGGCAGAATTCTTTCTGGACTCGAGTCCAGAAAGAATTCTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130771.2-126s1c1
Sequence:CCGGACTCCGTCTGTGGCCATTATACTCGAGTATAATGGCCACAGACGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175632
OSCAR MISSION shRNA Bacterial Glycerol Stock
osteoclast associated, immunoglobulin-like receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175632.2-1132s1c1
Sequence:CCGGCGTTGGGATCATAGGTTCATTCTCGAGAATGAACCTATGATCCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-802s1c1
Sequence:CCGGGCATCATAGTTACTTGTGATTCTCGAGAATCACAAGTAACTATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-411s1c1
Sequence:CCGGCAGCCCAGTAATGTTCTGGAACTCGAGTTCCAGAACATTACTGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-413s1c1
Sequence:CCGGGCCCAGTAATGTTCTGGAACTCTCGAGAGTTCCAGAACATTACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-737s1c1
Sequence:CCGGCTTGGACTATACCCAGGGAAACTCGAGTTTCCCTGGGTATAGTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175632
OSCAR MISSION shRNA shRNA Plasmid DNA
osteoclast associated, immunoglobulin-like receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175632.2-1132s1c1
Sequence:CCGGCGTTGGGATCATAGGTTCATTCTCGAGAATGAACCTATGATCCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-802s1c1
Sequence:CCGGGCATCATAGTTACTTGTGATTCTCGAGAATCACAAGTAACTATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-411s1c1
Sequence:CCGGCAGCCCAGTAATGTTCTGGAACTCGAGTTCCAGAACATTACTGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-413s1c1
Sequence:CCGGGCCCAGTAATGTTCTGGAACTCTCGAGAGTTCCAGAACATTACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-737s1c1
Sequence:CCGGCTTGGACTATACCCAGGGAAACTCGAGTTTCCCTGGGTATAGTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175632
OSCAR MISSION shRNA Lentiviral Transduction Particles
osteoclast associated, immunoglobulin-like receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175632.2-1132s1c1
Sequence:CCGGCGTTGGGATCATAGGTTCATTCTCGAGAATGAACCTATGATCCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-802s1c1
Sequence:CCGGGCATCATAGTTACTTGTGATTCTCGAGAATCACAAGTAACTATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-411s1c1
Sequence:CCGGCAGCCCAGTAATGTTCTGGAACTCGAGTTCCAGAACATTACTGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-413s1c1
Sequence:CCGGGCCCAGTAATGTTCTGGAACTCTCGAGAGTTCCAGAACATTACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175632.2-737s1c1
Sequence:CCGGCTTGGACTATACCCAGGGAAACTCGAGTTTCCCTGGGTATAGTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)