EMAIL THIS PAGE TO A FRIEND

OSCP1

organic solute carrier partner 1

59 Gene Product Result for
Synonyms: C1orf102 NOR1
Gene ID:
Mouse(230751) organic solute carrier partner 1
Rat(362595) organic solute carrier partner 1
chicken(428220) organic solute carrier partner 1
dog(475334) organic solute carrier partner 1
cow(504974) organic solute carrier partner 1
Horse(100054927) organic solute carrier partner 1
domestic cat(101087852) organic solute carrier partner 1
sheep(101113543) organic solute carrier partner 1
domestic guinea pig(100721806) organic solute carrier partner 1
naked mole-rat(101722556) organic solute carrier partner 1
Domestic Rabbit(100345275) organic solute carrier partner 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145047 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132961 MISSION® esiRNA esiRNA human C1orf102 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145047 Rosetta Predictions human pricing
NM_206837 Rosetta Predictions human pricing
NM_001029923 Rosetta Predictions rat pricing
NM_172701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130511 predicted 620
2 SASI_Hs01_00130512 predicted 851
3 SASI_Hs01_00130513 predicted 445
4 SASI_Hs01_00130515 predicted 1091
5 SASI_Hs01_00130516 predicted 493
6 SASI_Hs01_00130517 predicted 270
7 SASI_Hs01_00130519 predicted 933
8 SASI_Hs02_00364926 predicted 522
9 SASI_Hs02_00364927 predicted 859
10 SASI_Hs02_00364928 predicted 1077
11 SASI_Hs01_00130514 predicted 753
12 SASI_Hs01_00130518 predicted 839
13 SASI_Hs01_00130520 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053567 predicted 211
2 SASI_Hs01_00053568 predicted 490
3 SASI_Hs01_00053569 predicted 304
4 SASI_Hs01_00053570 predicted 414
5 SASI_Hs01_00053571 predicted 350
6 SASI_Hs01_00053572 predicted 245
7 SASI_Hs01_00053573 predicted 465
8 SASI_Hs01_00053574 predicted 475
9 SASI_Hs02_00373567 predicted 363
10 SASI_Hs01_00053576 predicted 349
11 SASI_Hs01_00053575 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097491 predicted 580
2 SASI_Rn01_00097492 predicted 897
3 SASI_Rn01_00097494 predicted 593
4 SASI_Rn01_00097495 predicted 918
5 SASI_Rn01_00097496 predicted 550
6 SASI_Rn01_00097497 predicted 1025
7 SASI_Rn01_00097498 predicted 402
8 SASI_Rn01_00097499 predicted 430
9 SASI_Rn01_00097500 predicted 549
10 SASI_Rn02_00203496 predicted 1051
11 SASI_Rn01_00097493 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119218 predicted 837
2 SASI_Mm01_00119219 predicted 935
3 SASI_Mm01_00119220 predicted 257
4 SASI_Mm01_00119221 predicted 1111
5 SASI_Mm02_00344453 predicted 1231
6 SASI_Mm01_00119222 predicted 971
7 SASI_Mm01_00119223 predicted 649
8 SASI_Mm02_00344454 predicted 1170
9 SASI_Mm01_00119224 predicted 617
10 SASI_Mm01_00119225 predicted 885
11 SASI_Mm01_00119217 predicted 613
12 SASI_Mm01_00119226 predicted 1137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145047
OSCP1 MISSION shRNA Bacterial Glycerol Stock
organic solute carrier partner 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-1032s1c1
Sequence:CCGGGATTCCGGTTGAATCTCTTTACTCGAGTAAAGAGATTCAACCGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-895s1c1
Sequence:CCGGGTCTGGATCATCAAAGAACTTCTCGAGAAGTTCTTTGATGATCCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145047.3-229s1c1
Sequence:CCGGGAATGACATCATCTCCACCATCTCGAGATGGTGGAGATGATGTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-1231s1c1
Sequence:CCGGCGCCATGATGGATGAGTTATACTCGAGTATAACTCATCCATCATGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145047.3-1326s1c1
Sequence:CCGGCCAGAATGATGCTGCTAGTTTCTCGAGAAACTAGCAGCATCATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-625s1c1
Sequence:CCGGCCGAGTATCCATGTTTCTAAACTCGAGTTTAGAAACATGGATACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145047.4-859s21c1
Sequence:CCGGCTAACATGTACAGCGTGAATCCTCGAGGATTCACGCTGTACATGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145047.4-516s21c1
Sequence:CCGGCAGCAAGTGGACGAGACTTTGCTCGAGCAAAGTCTCGTCCACTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145047.4-1100s21c1
Sequence:CCGGAGAGTTATCCTATGAAGTTATCTCGAGATAACTTCATAGGATAACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145047
OSCP1 MISSION shRNA shRNA Plasmid DNA
organic solute carrier partner 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-1032s1c1
Sequence:CCGGGATTCCGGTTGAATCTCTTTACTCGAGTAAAGAGATTCAACCGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-895s1c1
Sequence:CCGGGTCTGGATCATCAAAGAACTTCTCGAGAAGTTCTTTGATGATCCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145047.3-229s1c1
Sequence:CCGGGAATGACATCATCTCCACCATCTCGAGATGGTGGAGATGATGTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-1231s1c1
Sequence:CCGGCGCCATGATGGATGAGTTATACTCGAGTATAACTCATCCATCATGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145047.3-1326s1c1
Sequence:CCGGCCAGAATGATGCTGCTAGTTTCTCGAGAAACTAGCAGCATCATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-625s1c1
Sequence:CCGGCCGAGTATCCATGTTTCTAAACTCGAGTTTAGAAACATGGATACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145047.4-859s21c1
Sequence:CCGGCTAACATGTACAGCGTGAATCCTCGAGGATTCACGCTGTACATGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145047.4-516s21c1
Sequence:CCGGCAGCAAGTGGACGAGACTTTGCTCGAGCAAAGTCTCGTCCACTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145047.4-1100s21c1
Sequence:CCGGAGAGTTATCCTATGAAGTTATCTCGAGATAACTTCATAGGATAACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145047
OSCP1 MISSION shRNA Lentiviral Transduction Particles
organic solute carrier partner 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-1032s1c1
Sequence:CCGGGATTCCGGTTGAATCTCTTTACTCGAGTAAAGAGATTCAACCGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-895s1c1
Sequence:CCGGGTCTGGATCATCAAAGAACTTCTCGAGAAGTTCTTTGATGATCCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145047.3-229s1c1
Sequence:CCGGGAATGACATCATCTCCACCATCTCGAGATGGTGGAGATGATGTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-1231s1c1
Sequence:CCGGCGCCATGATGGATGAGTTATACTCGAGTATAACTCATCCATCATGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145047.3-1326s1c1
Sequence:CCGGCCAGAATGATGCTGCTAGTTTCTCGAGAAACTAGCAGCATCATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145047.3-625s1c1
Sequence:CCGGCCGAGTATCCATGTTTCTAAACTCGAGTTTAGAAACATGGATACTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145047.4-859s21c1
Sequence:CCGGCTAACATGTACAGCGTGAATCCTCGAGGATTCACGCTGTACATGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145047.4-516s21c1
Sequence:CCGGCAGCAAGTGGACGAGACTTTGCTCGAGCAAAGTCTCGTCCACTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145047.4-1100s21c1
Sequence:CCGGAGAGTTATCCTATGAAGTTATCTCGAGATAACTTCATAGGATAACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172701
OSCP1 MISSION shRNA Bacterial Glycerol Stock
organic solute carrier partner 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000264408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172701.2-444s21c1
Sequence:CCGGGACGTGTTGCTGGTCACTTTCCTCGAGGAAAGTGACCAGCAACACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172701.2-624s21c1
Sequence:CCGGCATATCCGAGTGTCCACATTTCTCGAGAAATGTGGACACTCGGATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172701.2-1735s21c1
Sequence:CCGGTGTACACTTGGTGACAGAAATCTCGAGATTTCTGTCACCAAGTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172701.2-268s21c1
Sequence:CCGGTCATGGACGAACTGTTCAAACCTCGAGGTTTGAACAGTTCGTCCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172701
OSCP1 MISSION shRNA shRNA Plasmid DNA
organic solute carrier partner 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000264408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172701.2-444s21c1
Sequence:CCGGGACGTGTTGCTGGTCACTTTCCTCGAGGAAAGTGACCAGCAACACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172701.2-624s21c1
Sequence:CCGGCATATCCGAGTGTCCACATTTCTCGAGAAATGTGGACACTCGGATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172701.2-1735s21c1
Sequence:CCGGTGTACACTTGGTGACAGAAATCTCGAGATTTCTGTCACCAAGTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172701.2-268s21c1
Sequence:CCGGTCATGGACGAACTGTTCAAACCTCGAGGTTTGAACAGTTCGTCCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172701
OSCP1 MISSION shRNA Lentiviral Transduction Particles
organic solute carrier partner 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000264408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172701.2-444s21c1
Sequence:CCGGGACGTGTTGCTGGTCACTTTCCTCGAGGAAAGTGACCAGCAACACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172701.2-624s21c1
Sequence:CCGGCATATCCGAGTGTCCACATTTCTCGAGAAATGTGGACACTCGGATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172701.2-1735s21c1
Sequence:CCGGTGTACACTTGGTGACAGAAATCTCGAGATTTCTGTCACCAAGTGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172701.2-268s21c1
Sequence:CCGGTCATGGACGAACTGTTCAAACCTCGAGGTTTGAACAGTTCGTCCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)