EMAIL THIS PAGE TO A FRIEND

OSER1

oxidative stress responsive serine-rich 1

58 Gene Product Result for
Synonyms: C20orf111 HSPC207 Osr1 Perit1 dJ1183I21.1
UniProtKB ID: Q9NX31, B2RCK4, O95912, Q9NZ84, Q9P0R8
Gene ID:
Mouse(66680) oxidative stress responsive serine rich 1
Rat(296346) oxidative stress responsive serine-rich 1
Zebrafish(393328) oxidative stress responsive serine-rich 1
cow(510457) chromosome 13 open reading frame, human C20orf111
naked mole-rat(101713175) oxidative stress responsive serine-rich 1
domestic guinea pig(100735822) oxidative stress responsive serine-rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045125 Anti-OSER1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016470 Rosetta Predictions human pricing
NM_201560 Rosetta Predictions rat pricing
NM_025699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033019 predicted 995
2 SASI_Hs01_00033020 predicted 403
3 SASI_Hs01_00033021 predicted 1008
4 SASI_Hs01_00033022 predicted 670
5 SASI_Hs01_00033023 predicted 957
6 SASI_Hs01_00033024 predicted 999
7 SASI_Hs01_00033025 predicted 754
8 SASI_Hs01_00033026 predicted 666
9 SASI_Hs01_00033027 predicted 533
10 SASI_Hs01_00033028 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072936 predicted 937
2 SASI_Rn01_00072938 predicted 1001
3 SASI_Rn01_00072939 predicted 932
4 SASI_Rn01_00072940 predicted 742
5 SASI_Rn01_00072942 predicted 647
6 SASI_Rn01_00072943 predicted 363
7 SASI_Rn01_00072944 predicted 298
8 SASI_Rn01_00072945 predicted 1029
9 SASI_Rn02_00270331 predicted 655
10 SASI_Rn02_00270332 predicted 343
11 SASI_Rn01_00072937 predicted 644
12 SASI_Rn01_00072941 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158319 predicted 985
2 SASI_Mm01_00158320 predicted 916
3 SASI_Mm02_00328866 predicted 926
4 SASI_Mm02_00328867 predicted 989
5 SASI_Mm02_00328868 predicted 242
6 SASI_Mm01_00158323 predicted 338
7 SASI_Mm01_00158324 predicted 627
8 SASI_Mm01_00158325 predicted 631
9 SASI_Mm01_00158327 predicted 275
10 SASI_Mm01_00158328 predicted 653
11 SASI_Mm01_00158321 predicted 908
12 SASI_Mm01_00158322 predicted 623
13 SASI_Mm01_00158326 predicted 504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016470
VALIDATED
OSER1 MISSION shRNA Bacterial Glycerol Stock
oxidative stress responsive serine-rich 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016470.6-539s1c1
Sequence:CCGGCTCTACTTCTCTCGATGCTAACTCGAGTTAGCATCGAGAGAAGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016470.6-1051s1c1
Sequence:CCGGGAAGGCTTGTCAAAGAGATTTCTCGAGAAATCTCTTTGACAAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016470.6-1392s1c1
Sequence:CCGGGCACTAAACATTTGTCATGCTCTCGAGAGCATGACAAATGTTTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016470.6-273s1c1
Sequence:CCGGGCAACAGATGATACCAAACCTCTCGAGAGGTTTGGTATCATCTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016470.6-1038s1c1
Sequence:CCGGGCTTTAAACCAATGAAGGCTTCTCGAGAAGCCTTCATTGGTTTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016470.6-1051s21c1
Sequence:CCGGGAAGGCTTGTCAAAGAGATTTCTCGAGAAATCTCTTTGACAAGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016470.6-1421s1c1
Sequence:CCGGCAGCCCAGAATATTAGAAGTTCTCGAGAACTTCTAATATTCTGGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016470.6-421s1c1
Sequence:CCGGGCAGTACAATAGCGTCTTCTTCTCGAGAAGAAGACGCTATTGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016470.6-683s21c1
Sequence:CCGGCTCTGACTTTCAATCAGTTTCCTCGAGGAAACTGATTGAAAGTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016470.6-1012s21c1
Sequence:CCGGCCTGATAGCAAGAAGCTAATTCTCGAGAATTAGCTTCTTGCTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016470.6-753s21c1
Sequence:CCGGTGTAAGAGATGGCATGATATGCTCGAGCATATCATGCCATCTCTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016470.6-945s21c1
Sequence:CCGGTCAGGCTACATGGAGTATTACCTCGAGGTAATACTCCATGTAGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016470
VALIDATED
OSER1 MISSION shRNA shRNA Plasmid DNA
oxidative stress responsive serine-rich 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016470.6-539s1c1
Sequence:CCGGCTCTACTTCTCTCGATGCTAACTCGAGTTAGCATCGAGAGAAGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016470.6-1051s1c1
Sequence:CCGGGAAGGCTTGTCAAAGAGATTTCTCGAGAAATCTCTTTGACAAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016470.6-1392s1c1
Sequence:CCGGGCACTAAACATTTGTCATGCTCTCGAGAGCATGACAAATGTTTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016470.6-273s1c1
Sequence:CCGGGCAACAGATGATACCAAACCTCTCGAGAGGTTTGGTATCATCTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016470.6-1038s1c1
Sequence:CCGGGCTTTAAACCAATGAAGGCTTCTCGAGAAGCCTTCATTGGTTTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016470.6-1051s21c1
Sequence:CCGGGAAGGCTTGTCAAAGAGATTTCTCGAGAAATCTCTTTGACAAGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016470.6-1421s1c1
Sequence:CCGGCAGCCCAGAATATTAGAAGTTCTCGAGAACTTCTAATATTCTGGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016470.6-421s1c1
Sequence:CCGGGCAGTACAATAGCGTCTTCTTCTCGAGAAGAAGACGCTATTGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016470.6-683s21c1
Sequence:CCGGCTCTGACTTTCAATCAGTTTCCTCGAGGAAACTGATTGAAAGTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016470.6-1012s21c1
Sequence:CCGGCCTGATAGCAAGAAGCTAATTCTCGAGAATTAGCTTCTTGCTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016470.6-753s21c1
Sequence:CCGGTGTAAGAGATGGCATGATATGCTCGAGCATATCATGCCATCTCTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016470.6-945s21c1
Sequence:CCGGTCAGGCTACATGGAGTATTACCTCGAGGTAATACTCCATGTAGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016470
VALIDATED
OSER1 MISSION shRNA Lentiviral Transduction Particles
oxidative stress responsive serine-rich 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016470.6-539s1c1
Sequence:CCGGCTCTACTTCTCTCGATGCTAACTCGAGTTAGCATCGAGAGAAGTAGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000128875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016470.6-1051s1c1
Sequence:CCGGGAAGGCTTGTCAAAGAGATTTCTCGAGAAATCTCTTTGACAAGCCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000128980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016470.6-1392s1c1
Sequence:CCGGGCACTAAACATTTGTCATGCTCTCGAGAGCATGACAAATGTTTAGTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016470.6-273s1c1
Sequence:CCGGGCAACAGATGATACCAAACCTCTCGAGAGGTTTGGTATCATCTGTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016470.6-1038s1c1
Sequence:CCGGGCTTTAAACCAATGAAGGCTTCTCGAGAAGCCTTCATTGGTTTAAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000276371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016470.6-1051s21c1
Sequence:CCGGGAAGGCTTGTCAAAGAGATTTCTCGAGAAATCTCTTTGACAAGCCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016470.6-1421s1c1
Sequence:CCGGCAGCCCAGAATATTAGAAGTTCTCGAGAACTTCTAATATTCTGGGCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016470.6-421s1c1
Sequence:CCGGGCAGTACAATAGCGTCTTCTTCTCGAGAAGAAGACGCTATTGTACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000276328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016470.6-683s21c1
Sequence:CCGGCTCTGACTTTCAATCAGTTTCCTCGAGGAAACTGATTGAAAGTCAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000276329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016470.6-1012s21c1
Sequence:CCGGCCTGATAGCAAGAAGCTAATTCTCGAGAATTAGCTTCTTGCTATCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000276330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016470.6-753s21c1
Sequence:CCGGTGTAAGAGATGGCATGATATGCTCGAGCATATCATGCCATCTCTTACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000276331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016470.6-945s21c1
Sequence:CCGGTCAGGCTACATGGAGTATTACCTCGAGGTAATACTCCATGTAGCCTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025699
VALIDATED
OSER1 MISSION shRNA Bacterial Glycerol Stock
oxidative stress responsive serine-rich 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025699.2-784s1c1
Sequence:CCGGCCCAGAACGAAGATCACTTGACTCGAGTCAAGTGATCTTCGTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025699.2-639s21c1
Sequence:CCGGCTAACGATCTCTCTGACTTTCCTCGAGGAAAGTCAGAGAGATCGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025699.2-908s21c1
Sequence:CCGGGCAGGCTACATGGAGTATTACCTCGAGGTAATACTCCATGTAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025699.2-1261s21c1
Sequence:CCGGTCCTTATAAGACAGCATATTTCTCGAGAAATATGCTGTCTTATAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025699.2-638s1c1
Sequence:CCGGGCTAACGATCTCTCTGACTTTCTCGAGAAAGTCAGAGAGATCGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025699.2-1262s1c1
Sequence:CCGGCCTTATAAGACAGCATATTTCCTCGAGGAAATATGCTGTCTTATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025699.2-171s21c1
Sequence:CCGGACGCATCAGGGTCCATCATATCTCGAGATATGATGGACCCTGATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025699.2-232s21c1
Sequence:CCGGCAGAACAGCAGCCGATGATACCTCGAGGTATCATCGGCTGCTGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025699
VALIDATED
OSER1 MISSION shRNA shRNA Plasmid DNA
oxidative stress responsive serine-rich 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025699.2-784s1c1
Sequence:CCGGCCCAGAACGAAGATCACTTGACTCGAGTCAAGTGATCTTCGTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025699.2-639s21c1
Sequence:CCGGCTAACGATCTCTCTGACTTTCCTCGAGGAAAGTCAGAGAGATCGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025699.2-908s21c1
Sequence:CCGGGCAGGCTACATGGAGTATTACCTCGAGGTAATACTCCATGTAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025699.2-1261s21c1
Sequence:CCGGTCCTTATAAGACAGCATATTTCTCGAGAAATATGCTGTCTTATAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025699.2-638s1c1
Sequence:CCGGGCTAACGATCTCTCTGACTTTCTCGAGAAAGTCAGAGAGATCGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025699.2-1262s1c1
Sequence:CCGGCCTTATAAGACAGCATATTTCCTCGAGGAAATATGCTGTCTTATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025699.2-171s21c1
Sequence:CCGGACGCATCAGGGTCCATCATATCTCGAGATATGATGGACCCTGATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025699.2-232s21c1
Sequence:CCGGCAGAACAGCAGCCGATGATACCTCGAGGTATCATCGGCTGCTGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025699
VALIDATED
OSER1 MISSION shRNA Lentiviral Transduction Particles
oxidative stress responsive serine-rich 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025699.2-784s1c1
Sequence:CCGGCCCAGAACGAAGATCACTTGACTCGAGTCAAGTGATCTTCGTTCTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025699.2-639s21c1
Sequence:CCGGCTAACGATCTCTCTGACTTTCCTCGAGGAAAGTCAGAGAGATCGTTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000283193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025699.2-908s21c1
Sequence:CCGGGCAGGCTACATGGAGTATTACCTCGAGGTAATACTCCATGTAGCCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025699.2-1261s21c1
Sequence:CCGGTCCTTATAAGACAGCATATTTCTCGAGAAATATGCTGTCTTATAAGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000178069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025699.2-638s1c1
Sequence:CCGGGCTAACGATCTCTCTGACTTTCTCGAGAAAGTCAGAGAGATCGTTAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000215950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025699.2-1262s1c1
Sequence:CCGGCCTTATAAGACAGCATATTTCCTCGAGGAAATATGCTGTCTTATAAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025699.2-171s21c1
Sequence:CCGGACGCATCAGGGTCCATCATATCTCGAGATATGATGGACCCTGATGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025699.2-232s21c1
Sequence:CCGGCAGAACAGCAGCCGATGATACCTCGAGGTATCATCGGCTGCTGTTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???