EMAIL THIS PAGE TO A FRIEND

OSGEPL1

O-sialoglycoprotein endopeptidase-like 1

48 Gene Product Result for
Synonyms: Qri7
UniProtKB ID: Q9H4B0, Q96EV9, Q96NH5
Gene ID:
Mouse(72085) O-sialoglycoprotein endopeptidase-like 1
Rat(314548) O-sialoglycoprotein endopeptidase-like 1
naked mole-rat(101709973) O-sialoglycoprotein endopeptidase-like 1
Domestic Rabbit(100341521) O-sialoglycoprotein endopeptidase-like 1
domestic guinea pig(100717050) O-sialoglycoprotein endopeptidase-like 1
sheep(101113042) O-sialoglycoprotein endopeptidase-like 1
Zebrafish(368635) O-sialoglycoprotein endopeptidase-like 1
chicken(423982) O-sialoglycoprotein endopeptidase-like 1
dog(478839) O-sialoglycoprotein endopeptidase-like 1
domestic cat(101080394) O-sialoglycoprotein endopeptidase-like 1
Horse(100069296) O-sialoglycoprotein endopeptidase-like 1
cow(514738) O-sialoglycoprotein endopeptidase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA030693 Anti-OSGEPL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055081 MISSION® esiRNA esiRNA human OSGEPL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022353 Rosetta Predictions human pricing
NM_001024787 Rosetta Predictions rat pricing
NM_028091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240776 predicted 985
2 SASI_Hs02_00355646 predicted 1200
3 SASI_Hs02_00355647 predicted 1292
4 SASI_Hs01_00240777 predicted 846
5 SASI_Hs01_00240778 predicted 993
6 SASI_Hs01_00240779 predicted 1094
7 SASI_Hs01_00240780 predicted 1216
8 SASI_Hs02_00355648 predicted 1211
9 SASI_Hs01_00240782 predicted 987
10 SASI_Hs01_00240783 predicted 1141
11 SASI_Hs01_00240781 predicted 1128
12 SASI_Hs01_00240784 predicted 559
13 SASI_Hs01_00240785 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072917 predicted 808
2 SASI_Rn01_00072918 predicted 577
3 SASI_Rn02_00202694 predicted 959
4 SASI_Rn01_00072919 predicted 544
5 SASI_Rn01_00072920 predicted 1458
6 SASI_Rn02_00202695 predicted 537
7 SASI_Rn01_00072921 predicted 1356
8 SASI_Rn01_00072922 predicted 1122
9 SASI_Rn01_00072923 predicted 1370
10 SASI_Rn01_00072924 predicted 885
11 SASI_Rn01_00072916 predicted 366
12 SASI_Rn01_00072925 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183390 predicted 901
2 SASI_Mm01_00183391 predicted 500
3 SASI_Mm01_00183392 predicted 931
4 SASI_Mm01_00183393 predicted 1526
5 SASI_Mm01_00183394 predicted 987
6 SASI_Mm01_00183395 predicted 975
7 SASI_Mm02_00333327 predicted 1255
8 SASI_Mm02_00333328 predicted 459
9 SASI_Mm01_00183396 predicted 673
10 SASI_Mm01_00183397 predicted 1297
11 SASI_Mm01_00183398 predicted 421
12 SASI_Mm01_00183399 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022353
VALIDATED
OSGEPL1 MISSION shRNA Bacterial Glycerol Stock
O-sialoglycoprotein endopeptidase-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022353.2-994s21c1
Sequence:CCGGACTATTAGGTTGACCAATAAACTCGAGTTTATTGGTCAACCTAATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022353.2-1300s21c1
Sequence:CCGGCTTCAACACGTTACTGATAAACTCGAGTTTATCAGTAACGTGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_022353.1-744s1c1
Sequence:CCGGCCTCCCTTGCATCATGCTAAACTCGAGTTTAGCATGATGCAAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022353.1-213s1c1
Sequence:CCGGGCAATACATTCCCAAACTGAACTCGAGTTCAGTTTGGGAATGTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022353.1-339s1c1
Sequence:CCGGCCAAGTGACCTCTCAGCAATTCTCGAGAATTGCTGAGAGGTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_022353.1-1075s1c1
Sequence:CCGGGTGTCGCAAGTAACTTCTATACTCGAGTATAGAAGTTACTTGCGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_022353.1-1161s1c1
Sequence:CCGGCTATGCACTGATAATGGCATTCTCGAGAATGCCATTATCAGTGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022353
VALIDATED
OSGEPL1 MISSION shRNA shRNA Plasmid DNA
O-sialoglycoprotein endopeptidase-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022353.2-994s21c1
Sequence:CCGGACTATTAGGTTGACCAATAAACTCGAGTTTATTGGTCAACCTAATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022353.2-1300s21c1
Sequence:CCGGCTTCAACACGTTACTGATAAACTCGAGTTTATCAGTAACGTGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_022353.1-744s1c1
Sequence:CCGGCCTCCCTTGCATCATGCTAAACTCGAGTTTAGCATGATGCAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022353.1-213s1c1
Sequence:CCGGGCAATACATTCCCAAACTGAACTCGAGTTCAGTTTGGGAATGTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022353.1-339s1c1
Sequence:CCGGCCAAGTGACCTCTCAGCAATTCTCGAGAATTGCTGAGAGGTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_022353.1-1075s1c1
Sequence:CCGGGTGTCGCAAGTAACTTCTATACTCGAGTATAGAAGTTACTTGCGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_022353.1-1161s1c1
Sequence:CCGGCTATGCACTGATAATGGCATTCTCGAGAATGCCATTATCAGTGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022353
VALIDATED
OSGEPL1 MISSION shRNA Lentiviral Transduction Particles
O-sialoglycoprotein endopeptidase-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022353.2-994s21c1
Sequence:CCGGACTATTAGGTTGACCAATAAACTCGAGTTTATTGGTCAACCTAATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022353.2-1300s21c1
Sequence:CCGGCTTCAACACGTTACTGATAAACTCGAGTTTATCAGTAACGTGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_022353.1-744s1c1
Sequence:CCGGCCTCCCTTGCATCATGCTAAACTCGAGTTTAGCATGATGCAAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022353.1-213s1c1
Sequence:CCGGGCAATACATTCCCAAACTGAACTCGAGTTCAGTTTGGGAATGTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022353.1-339s1c1
Sequence:CCGGCCAAGTGACCTCTCAGCAATTCTCGAGAATTGCTGAGAGGTCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_022353.1-1075s1c1
Sequence:CCGGGTGTCGCAAGTAACTTCTATACTCGAGTATAGAAGTTACTTGCGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_022353.1-1161s1c1
Sequence:CCGGCTATGCACTGATAATGGCATTCTCGAGAATGCCATTATCAGTGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028091
VALIDATED
OSGEPL1 MISSION shRNA Bacterial Glycerol Stock
O-sialoglycoprotein endopeptidase-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-536s1c1
Sequence:CCGGCCAAGCGATCTCTCAGCAATTCTCGAGAATTGCTGAGAGATCGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-952s1c1
Sequence:CCGGGAATGCTAAGAATTGCGATTTCTCGAGAAATCGCAATTCTTAGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-497s1c1
Sequence:CCGGCGAATAGTAGAAGAAACTCTTCTCGAGAAGAGTTTCTTCTACTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-1361s1c1
Sequence:CCGGGTAGAAGACATCCGATATGAACTCGAGTTCATATCGGATGTCTTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028091.2-784s1c1
Sequence:CCGGCCTTGGGAAGTCTTTGGACATCTCGAGATGTCCAAAGACTTCCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028091
VALIDATED
OSGEPL1 MISSION shRNA shRNA Plasmid DNA
O-sialoglycoprotein endopeptidase-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-536s1c1
Sequence:CCGGCCAAGCGATCTCTCAGCAATTCTCGAGAATTGCTGAGAGATCGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-952s1c1
Sequence:CCGGGAATGCTAAGAATTGCGATTTCTCGAGAAATCGCAATTCTTAGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-497s1c1
Sequence:CCGGCGAATAGTAGAAGAAACTCTTCTCGAGAAGAGTTTCTTCTACTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-1361s1c1
Sequence:CCGGGTAGAAGACATCCGATATGAACTCGAGTTCATATCGGATGTCTTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028091.2-784s1c1
Sequence:CCGGCCTTGGGAAGTCTTTGGACATCTCGAGATGTCCAAAGACTTCCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028091
VALIDATED
OSGEPL1 MISSION shRNA Lentiviral Transduction Particles
O-sialoglycoprotein endopeptidase-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-536s1c1
Sequence:CCGGCCAAGCGATCTCTCAGCAATTCTCGAGAATTGCTGAGAGATCGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-952s1c1
Sequence:CCGGGAATGCTAAGAATTGCGATTTCTCGAGAAATCGCAATTCTTAGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-497s1c1
Sequence:CCGGCGAATAGTAGAAGAAACTCTTCTCGAGAAGAGTTTCTTCTACTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028091.2-1361s1c1
Sequence:CCGGGTAGAAGACATCCGATATGAACTCGAGTTCATATCGGATGTCTTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028091.2-784s1c1
Sequence:CCGGCCTTGGGAAGTCTTTGGACATCTCGAGATGTCCAAAGACTTCCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)