EMAIL THIS PAGE TO A FRIEND

OSGIN1

oxidative stress induced growth inhibitor 1

69 Gene Product Result for
Synonyms: BDGI OKL38
UniProtKB ID: Q9UJX0, Q52M33, Q86UQ1, Q96S88, Q9BZ70
Gene ID:
Human(29948) Summary: This gene encodes an oxidative stress response protein that regulates cell death. Expression of the gene is regulated by p53 and is induced by DNA damage. The protein regulates apoptosis by inducing cytochrome c release from mitochondria. It also appears to be a key regulator of both inflammatory and anti-inflammatory molecules. The loss of this protein correlates with uncontrolled cell growth and tumor formation. Naturally occurring read-through transcription exists between this gene and the neighboring upstream malonyl-CoA decarboxylase (MLYCD) gene, but the read-through transcripts are unlikely to produce a protein product. [provided by RefSeq, Aug 2011]
Mouse(71839) oxidative stress induced growth inhibitor 1
Rat(171493) oxidative stress induced growth inhibitor 1
chicken(415706) oxidative stress induced growth inhibitor 1
cow(768073) oxidative stress induced growth inhibitor 1
Horse(100070078) oxidative stress induced growth inhibitor 1
domestic cat(101086865) oxidative stress induced growth inhibitor 1
dog(489687) oxidative stress induced growth inhibitor 1
sheep(101122544) oxidative stress induced growth inhibitor 1
domestic guinea pig(100731240) oxidative stress induced growth inhibitor 1
naked mole-rat(101715060) oxidative stress induced growth inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013370 Rosetta Predictions human pricing
NM_182980 Rosetta Predictions human pricing
NM_182981 Rosetta Predictions human pricing
NM_138504 Rosetta Predictions rat pricing
NM_027950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168042 predicted 1200
2 SASI_Hs01_00168043 predicted 1543
3 SASI_Hs01_00168044 predicted 851
4 SASI_Hs01_00168045 predicted 1532
5 SASI_Hs01_00168046 predicted 853
6 SASI_Hs01_00168047 predicted 1150
7 SASI_Hs01_00168048 predicted 1165
8 SASI_Hs01_00168049 predicted 1481
9 SASI_Hs02_00344711 predicted 2122
10 SASI_Hs01_00168050 predicted 1208
11 SASI_Hs01_00168051 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186402 predicted 1036
2 SASI_Hs01_00186403 predicted 1376
3 SASI_Hs01_00186404 predicted 700
4 SASI_Hs01_00186405 predicted 1371
5 SASI_Hs01_00186406 predicted 698
6 SASI_Hs01_00186407 predicted 990
7 SASI_Hs01_00186408 predicted 1008
8 SASI_Hs01_00186409 predicted 1317
9 SASI_Hs02_00371152 predicted 1965
10 SASI_Hs01_00186410 predicted 1051
11 SASI_Hs01_00186411 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128468 predicted 744
2 SASI_Hs01_00128469 predicted 1090
3 SASI_Hs01_00128470 predicted 403
4 SASI_Hs01_00128471 predicted 1079
5 SASI_Hs01_00128472 predicted 404
6 SASI_Hs01_00128473 predicted 699
7 SASI_Hs01_00128474 predicted 714
8 SASI_Hs01_00128475 predicted 1024
9 SASI_Hs02_00371153 predicted 1671
10 SASI_Hs01_00128476 predicted 764
11 SASI_Hs01_00128477 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031163 predicted 2026
2 SASI_Rn01_00031164 predicted 1126
3 SASI_Rn01_00031165 predicted 1045
4 SASI_Rn01_00031166 predicted 735
5 SASI_Rn01_00031168 predicted 987
6 SASI_Rn02_00268094 predicted 970
7 SASI_Rn01_00031169 predicted 609
8 SASI_Rn01_00031170 predicted 1060
9 SASI_Rn01_00031171 predicted 1819
10 SASI_Rn01_00031172 predicted 1444
11 SASI_Rn01_00031167 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188179 predicted 1194
2 SASI_Mm01_00188180 predicted 632
3 SASI_Mm01_00188181 predicted 730
4 SASI_Mm02_00332958 predicted 1007
5 SASI_Mm01_00188182 predicted 1393
6 SASI_Mm01_00188183 predicted 1179
7 SASI_Mm01_00188184 predicted 1590
8 SASI_Mm01_00188185 predicted 714
9 SASI_Mm01_00188186 predicted 371
10 SASI_Mm01_00188187 predicted 824
11 SASI_Mm01_00188188 predicted 1597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013370
OSGIN1 MISSION shRNA Bacterial Glycerol Stock
oxidative stress induced growth inhibitor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013370.2-1985s1c1
Sequence:CCGGCAACTTCGTGAGGTTTGTGCACTCGAGTGCACAAACCTCACGAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013370.2-453s1c1
Sequence:CCGGCTCACCTCATCAGAGTTGTTTCTCGAGAAACAACTCTGATGAGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-910s21c1
Sequence:CCGGTACGCCCAGACACAGACTTTGCTCGAGCAAAGTCTGTGTCTGGGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-1981s21c1
Sequence:CCGGGGGACAACTTCGTGAGGTTTGCTCGAGCAAACCTCACGAAGTTGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-1774s21c1
Sequence:CCGGAGGGTGTCGAGAAGGTGTTTGCTCGAGCAAACACCTTCTCGACACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013370.3-2230s21c1
Sequence:CCGGGACCAGTGTCTGAGGTGGTAACTCGAGTTACCACCTCAGACACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-1486s21c1
Sequence:CCGGCAGACCCTGTCCTCATCATTGCTCGAGCAATGATGAGGACAGGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013370
OSGIN1 MISSION shRNA shRNA Plasmid DNA
oxidative stress induced growth inhibitor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013370.2-1985s1c1
Sequence:CCGGCAACTTCGTGAGGTTTGTGCACTCGAGTGCACAAACCTCACGAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013370.2-453s1c1
Sequence:CCGGCTCACCTCATCAGAGTTGTTTCTCGAGAAACAACTCTGATGAGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-910s21c1
Sequence:CCGGTACGCCCAGACACAGACTTTGCTCGAGCAAAGTCTGTGTCTGGGCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-1981s21c1
Sequence:CCGGGGGACAACTTCGTGAGGTTTGCTCGAGCAAACCTCACGAAGTTGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-1774s21c1
Sequence:CCGGAGGGTGTCGAGAAGGTGTTTGCTCGAGCAAACACCTTCTCGACACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013370.3-2230s21c1
Sequence:CCGGGACCAGTGTCTGAGGTGGTAACTCGAGTTACCACCTCAGACACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-1486s21c1
Sequence:CCGGCAGACCCTGTCCTCATCATTGCTCGAGCAATGATGAGGACAGGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013370
OSGIN1 MISSION shRNA Lentiviral Transduction Particles
oxidative stress induced growth inhibitor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013370.2-1985s1c1
Sequence:CCGGCAACTTCGTGAGGTTTGTGCACTCGAGTGCACAAACCTCACGAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013370.2-453s1c1
Sequence:CCGGCTCACCTCATCAGAGTTGTTTCTCGAGAAACAACTCTGATGAGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-910s21c1
Sequence:CCGGTACGCCCAGACACAGACTTTGCTCGAGCAAAGTCTGTGTCTGGGCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-1981s21c1
Sequence:CCGGGGGACAACTTCGTGAGGTTTGCTCGAGCAAACCTCACGAAGTTGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-1774s21c1
Sequence:CCGGAGGGTGTCGAGAAGGTGTTTGCTCGAGCAAACACCTTCTCGACACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013370.3-2230s21c1
Sequence:CCGGGACCAGTGTCTGAGGTGGTAACTCGAGTTACCACCTCAGACACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013370.3-1486s21c1
Sequence:CCGGCAGACCCTGTCCTCATCATTGCTCGAGCAATGATGAGGACAGGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027950
VALIDATED
OSGIN1 MISSION shRNA Bacterial Glycerol Stock
oxidative stress induced growth inhibitor 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027950.1-1407s1c1
Sequence:CCGGGACTTGGTCATAGACCCAGATCTCGAGATCTGGGTCTATGACCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027950.1-1399s21c1
Sequence:CCGGCAGGTGCTGACTTGGTCATAGCTCGAGCTATGACCAAGTCAGCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027950.1-1595s21c1
Sequence:CCGGCAGGAAGCCACCTTAACATTACTCGAGTAATGTTAAGGTGGCTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027950.1-451s21c1
Sequence:CCGGTGCGTCCTGACACAGACTTTGCTCGAGCAAAGTCTGTGTCAGGACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027950.1-1157s21c1
Sequence:CCGGCCAGCTGCCCAAGATGCTATACTCGAGTATAGCATCTTGGGCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027950.1-1641s21c1
Sequence:CCGGTGAAGAGGAAGAGGGCTTATCCTCGAGGATAAGCCCTCTTCCTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027950
VALIDATED
OSGIN1 MISSION shRNA shRNA Plasmid DNA
oxidative stress induced growth inhibitor 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027950.1-1407s1c1
Sequence:CCGGGACTTGGTCATAGACCCAGATCTCGAGATCTGGGTCTATGACCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027950.1-1399s21c1
Sequence:CCGGCAGGTGCTGACTTGGTCATAGCTCGAGCTATGACCAAGTCAGCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027950.1-1595s21c1
Sequence:CCGGCAGGAAGCCACCTTAACATTACTCGAGTAATGTTAAGGTGGCTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027950.1-451s21c1
Sequence:CCGGTGCGTCCTGACACAGACTTTGCTCGAGCAAAGTCTGTGTCAGGACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027950.1-1157s21c1
Sequence:CCGGCCAGCTGCCCAAGATGCTATACTCGAGTATAGCATCTTGGGCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027950.1-1641s21c1
Sequence:CCGGTGAAGAGGAAGAGGGCTTATCCTCGAGGATAAGCCCTCTTCCTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027950
VALIDATED
OSGIN1 MISSION shRNA Lentiviral Transduction Particles
oxidative stress induced growth inhibitor 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027950.1-1407s1c1
Sequence:CCGGGACTTGGTCATAGACCCAGATCTCGAGATCTGGGTCTATGACCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027950.1-1399s21c1
Sequence:CCGGCAGGTGCTGACTTGGTCATAGCTCGAGCTATGACCAAGTCAGCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027950.1-1595s21c1
Sequence:CCGGCAGGAAGCCACCTTAACATTACTCGAGTAATGTTAAGGTGGCTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027950.1-451s21c1
Sequence:CCGGTGCGTCCTGACACAGACTTTGCTCGAGCAAAGTCTGTGTCAGGACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027950.1-1157s21c1
Sequence:CCGGCCAGCTGCCCAAGATGCTATACTCGAGTATAGCATCTTGGGCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027950.1-1641s21c1
Sequence:CCGGTGAAGAGGAAGAGGGCTTATCCTCGAGGATAAGCCCTCTTCCTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)