EMAIL THIS PAGE TO A FRIEND

OSGIN2

oxidative stress induced growth inhibitor family member 2

78 Gene Product Result for
Synonyms: C8orf1 hT41
UniProtKB ID: Q9Y236
Gene ID:
Mouse(209212) oxidative stress induced growth inhibitor family member 2
Rat(313085) oxidative stress induced growth inhibitor family member 2
naked mole-rat(101722629) oxidative stress induced growth inhibitor family member 2
Domestic Rabbit(100351988) oxidative stress induced growth inhibitor family member 2
domestic guinea pig(100733474) oxidative stress induced growth inhibitor family member 2
sheep(101112070) oxidative stress induced growth inhibitor family member 2
Zebrafish(570268) oxidative stress induced growth inhibitor family member 2
cow(539073) oxidative stress induced growth inhibitor family member 2
Horse(100053523) oxidative stress induced growth inhibitor family member 2
domestic cat(101100362) oxidative stress induced growth inhibitor family member 2
dog(487038) oxidative stress induced growth inhibitor family member 2
chicken(420217) oxidative stress induced growth inhibitor family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004337 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126111 Rosetta Predictions human pricing
NM_004337 Rosetta Predictions human pricing
XM_001056612 Rosetta Predictions rat pricing
XM_232798 Rosetta Predictions rat pricing
NM_145950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328197 predicted 565
2 SASI_Hs02_00328198 predicted 1727
3 SASI_Hs02_00328199 predicted 1662
4 SASI_Hs02_00328200 predicted 1059
5 SASI_Hs02_00328201 predicted 1377
6 SASI_Hs02_00328202 predicted 1626
7 SASI_Hs02_00328203 predicted 629
8 SASI_Hs02_00328204 predicted 990
9 SASI_Hs02_00328205 predicted 912
10 SASI_Hs02_00328206 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171639 predicted 525
2 SASI_Hs02_00337393 predicted 1688
3 SASI_Hs01_00171640 predicted 1622
4 SASI_Hs02_00337394 predicted 1008
5 SASI_Hs01_00171642 predicted 1331
6 SASI_Hs01_00171643 predicted 1575
7 SASI_Hs01_00171644 predicted 591
8 SASI_Hs01_00171645 predicted 936
9 SASI_Hs01_00171646 predicted 869
10 SASI_Hs01_00171647 predicted 693
11 SASI_Hs01_00171641 predicted 683
12 SASI_Hs01_00171648 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283806 predicted 1854
2 SASI_Rn02_00283807 predicted 665
3 SASI_Rn02_00283808 predicted 1931
4 SASI_Rn02_00283809 predicted 1171
5 SASI_Rn02_00283810 predicted 1690
6 SASI_Rn02_00283811 predicted 1941
7 SASI_Rn02_00283812 predicted 1114
8 SASI_Rn02_00283813 predicted 2021
9 SASI_Rn02_00283814 predicted 676
10 SASI_Rn02_00283815 predicted 1809
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387255 predicted 721
2 SASI_Rn02_00387256 predicted 665
3 SASI_Rn02_00387257 predicted 2517
4 SASI_Rn02_00387258 predicted 540
5 SASI_Rn02_00387259 predicted 2485
6 SASI_Rn02_00387260 predicted 2448
7 SASI_Rn02_00387261 predicted 675
8 SASI_Rn02_00387262 predicted 2456
9 SASI_Rn02_00387263 predicted 2488
10 SASI_Rn02_00387264 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062665 predicted 631
2 SASI_Mm01_00062666 predicted 1855
3 SASI_Mm01_00062667 predicted 356
4 SASI_Mm01_00062668 predicted 1262
5 SASI_Mm02_00341416 predicted 1637
6 SASI_Mm01_00062669 predicted 1325
7 SASI_Mm01_00062671 predicted 1350
8 SASI_Mm01_00062672 predicted 1498
9 SASI_Mm01_00062673 predicted 1001
10 SASI_Mm01_00062674 predicted 1459
11 SASI_Mm01_00062670 predicted 1631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145950
VALIDATED
OSGIN2 MISSION shRNA Bacterial Glycerol Stock
oxidative stress induced growth inhibitor family member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-321s21c1
Sequence:CCGGAGCGACTTTGCCTATGGTAATCTCGAGATTACCATAGGCAAAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-286s21c1
Sequence:CCGGTTAGTTGAAGAAACGTCTTTACTCGAGTAAAGACGTTTCTTCAACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-385s21c1
Sequence:CCGGTCAGGCTACAGACCGTATTTACTCGAGTAAATACGGTCTGTAGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145950.3-2139s21c1
Sequence:CCGGCTGTAGCTCATTAGGCATTTACTCGAGTAAATGCCTAATGAGCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-1138s21c1
Sequence:CCGGGAGTTTGGAGCTGCTATAAACCTCGAGGTTTATAGCAGCTCCAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145950.2-1585s1c1
Sequence:CCGGGCCAATAACATGCAAGGGTAACTCGAGTTACCCTTGCATGTTATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145950.2-179s1c1
Sequence:CCGGGCCGGTCATTTCAGAAACTATCTCGAGATAGTTTCTGAAATGACCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145950.2-400s1c1
Sequence:CCGGGTATTTATCATCGGAAGCAATCTCGAGATTGCTTCCGATGATAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145950
VALIDATED
OSGIN2 MISSION shRNA shRNA Plasmid DNA
oxidative stress induced growth inhibitor family member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-321s21c1
Sequence:CCGGAGCGACTTTGCCTATGGTAATCTCGAGATTACCATAGGCAAAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-286s21c1
Sequence:CCGGTTAGTTGAAGAAACGTCTTTACTCGAGTAAAGACGTTTCTTCAACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-385s21c1
Sequence:CCGGTCAGGCTACAGACCGTATTTACTCGAGTAAATACGGTCTGTAGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145950.3-2139s21c1
Sequence:CCGGCTGTAGCTCATTAGGCATTTACTCGAGTAAATGCCTAATGAGCTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-1138s21c1
Sequence:CCGGGAGTTTGGAGCTGCTATAAACCTCGAGGTTTATAGCAGCTCCAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145950.2-1585s1c1
Sequence:CCGGGCCAATAACATGCAAGGGTAACTCGAGTTACCCTTGCATGTTATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145950.2-179s1c1
Sequence:CCGGGCCGGTCATTTCAGAAACTATCTCGAGATAGTTTCTGAAATGACCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145950.2-400s1c1
Sequence:CCGGGTATTTATCATCGGAAGCAATCTCGAGATTGCTTCCGATGATAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145950
VALIDATED
OSGIN2 MISSION shRNA Lentiviral Transduction Particles
oxidative stress induced growth inhibitor family member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-321s21c1
Sequence:CCGGAGCGACTTTGCCTATGGTAATCTCGAGATTACCATAGGCAAAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-286s21c1
Sequence:CCGGTTAGTTGAAGAAACGTCTTTACTCGAGTAAAGACGTTTCTTCAACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-385s21c1
Sequence:CCGGTCAGGCTACAGACCGTATTTACTCGAGTAAATACGGTCTGTAGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145950.3-2139s21c1
Sequence:CCGGCTGTAGCTCATTAGGCATTTACTCGAGTAAATGCCTAATGAGCTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145950.3-1138s21c1
Sequence:CCGGGAGTTTGGAGCTGCTATAAACCTCGAGGTTTATAGCAGCTCCAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145950.2-1585s1c1
Sequence:CCGGGCCAATAACATGCAAGGGTAACTCGAGTTACCCTTGCATGTTATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145950.2-179s1c1
Sequence:CCGGGCCGGTCATTTCAGAAACTATCTCGAGATAGTTTCTGAAATGACCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145950.2-400s1c1
Sequence:CCGGGTATTTATCATCGGAAGCAATCTCGAGATTGCTTCCGATGATAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004337
VALIDATED
OSGIN2 MISSION shRNA Bacterial Glycerol Stock
oxidative stress induced growth inhibitor family member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-2329s1c1
Sequence:CCGGCCCACAACTTACTTCCTGCATCTCGAGATGCAGGAAGTAAGTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-3668s1c1
Sequence:CCGGGCTGCAAATAAATCTGGTGAACTCGAGTTCACCAGATTTATTTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004337.1-423s1c1
Sequence:CCGGCTCAGGAATATGCCTTTCTTACTCGAGTAAGAAAGGCATATTCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-1340s1c1
Sequence:CCGGGCAGACGAGTAACTGATCCAACTCGAGTTGGATCAGTTACTCGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-3972s1c1
Sequence:CCGGGCAGATGTTGAAAGACCGTTTCTCGAGAAACGGTCTTTCAACATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-422s1c1
Sequence:CCGGCCTCAGGAATATGCCTTTCTTCTCGAGAAGAAAGGCATATTCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-2209s1c1
Sequence:CCGGGCAGTCATTATGCCAGAAATTCTCGAGAATTTCTGGCATAATGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004337.1-1635s1c1
Sequence:CCGGCCATAAGTCAAGCCAGCCAATCTCGAGATTGGCTGGCTTGACTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-1297s1c1
Sequence:CCGGCTGTGTGCTTACAACAGTAATCTCGAGATTACTGTTGTAAGCACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-1147s1c1
Sequence:CCGGCCTGCCCATCTGGAAATTGAACTCGAGTTCAATTTCCAGATGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-871s1c1
Sequence:CCGGGCTCGCTACTATAAACATTATCTCGAGATAATGTTTATAGTAGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004337
VALIDATED
OSGIN2 MISSION shRNA shRNA Plasmid DNA
oxidative stress induced growth inhibitor family member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-2329s1c1
Sequence:CCGGCCCACAACTTACTTCCTGCATCTCGAGATGCAGGAAGTAAGTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-3668s1c1
Sequence:CCGGGCTGCAAATAAATCTGGTGAACTCGAGTTCACCAGATTTATTTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004337.1-423s1c1
Sequence:CCGGCTCAGGAATATGCCTTTCTTACTCGAGTAAGAAAGGCATATTCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-1340s1c1
Sequence:CCGGGCAGACGAGTAACTGATCCAACTCGAGTTGGATCAGTTACTCGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-3972s1c1
Sequence:CCGGGCAGATGTTGAAAGACCGTTTCTCGAGAAACGGTCTTTCAACATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-422s1c1
Sequence:CCGGCCTCAGGAATATGCCTTTCTTCTCGAGAAGAAAGGCATATTCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-2209s1c1
Sequence:CCGGGCAGTCATTATGCCAGAAATTCTCGAGAATTTCTGGCATAATGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004337.1-1635s1c1
Sequence:CCGGCCATAAGTCAAGCCAGCCAATCTCGAGATTGGCTGGCTTGACTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-1297s1c1
Sequence:CCGGCTGTGTGCTTACAACAGTAATCTCGAGATTACTGTTGTAAGCACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-1147s1c1
Sequence:CCGGCCTGCCCATCTGGAAATTGAACTCGAGTTCAATTTCCAGATGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-871s1c1
Sequence:CCGGGCTCGCTACTATAAACATTATCTCGAGATAATGTTTATAGTAGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004337
VALIDATED
OSGIN2 MISSION shRNA Lentiviral Transduction Particles
oxidative stress induced growth inhibitor family member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-2329s1c1
Sequence:CCGGCCCACAACTTACTTCCTGCATCTCGAGATGCAGGAAGTAAGTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-3668s1c1
Sequence:CCGGGCTGCAAATAAATCTGGTGAACTCGAGTTCACCAGATTTATTTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004337.1-423s1c1
Sequence:CCGGCTCAGGAATATGCCTTTCTTACTCGAGTAAGAAAGGCATATTCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-1340s1c1
Sequence:CCGGGCAGACGAGTAACTGATCCAACTCGAGTTGGATCAGTTACTCGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-3972s1c1
Sequence:CCGGGCAGATGTTGAAAGACCGTTTCTCGAGAAACGGTCTTTCAACATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-422s1c1
Sequence:CCGGCCTCAGGAATATGCCTTTCTTCTCGAGAAGAAAGGCATATTCCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004337.1-2209s1c1
Sequence:CCGGGCAGTCATTATGCCAGAAATTCTCGAGAATTTCTGGCATAATGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004337.1-1635s1c1
Sequence:CCGGCCATAAGTCAAGCCAGCCAATCTCGAGATTGGCTGGCTTGACTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-1297s1c1
Sequence:CCGGCTGTGTGCTTACAACAGTAATCTCGAGATTACTGTTGTAAGCACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-1147s1c1
Sequence:CCGGCCTGCCCATCTGGAAATTGAACTCGAGTTCAATTTCCAGATGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004337.1-871s1c1
Sequence:CCGGGCTCGCTACTATAAACATTATCTCGAGATAATGTTTATAGTAGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)