EMAIL THIS PAGE TO A FRIEND

OSR1

odd-skipped related 1 (Drosophila)

83 Gene Product Result for
Synonyms: ODD
UniProtKB ID: Q8TAX0, B3KV97, D6W521
Gene ID:
Mouse(23967) odd-skipped related 1 (Drosophila)
Rat(298878) odd-skipped related 1 (Drosophila)
Zebrafish(450059) odd-skipped related 1 (Drosophila)
chicken(100316920) odd-skipped related 1 (Drosophila)
cow(539430) odd-skipped related 1 (Drosophila)
dog(482984) odd-skipped related 1 (Drosophila)
domestic cat(101081036) odd-skipped related 1 (Drosophila)
sheep(101102632) odd-skipped related 1 (Drosophila)
domestic guinea pig(100731944) odd-skipped related 1 (Drosophila)
naked mole-rat(101720599) odd-skipped related 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015525 Anti-OSR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
WH0130497M4 Monoclonal Anti-OSR1 antibody produced in mouse clone 3F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB1408872 Monoclonal Anti-OSR1 antibody produced in mouse clone 3F10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1408873 Monoclonal Anti-OSR1 antibody produced in mouse clone 2B4, ascites fluid, solution human
ELISA pricing
SAB1408874 Monoclonal Anti-OSR1 antibody produced in mouse clone 4B12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1408875 Monoclonal Anti-OSR1 antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1408876 Monoclonal Anti-OSR1 antibody produced in mouse clone 1G9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1408877 Monoclonal Anti-OSR1 antibody produced in mouse clone 3E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1408878 Monoclonal Anti-OSR1 antibody produced in mouse clone 1C6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1405355 Monoclonal Anti-OSR1, (N-terminal) antibody produced in mouse clone 1D5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145260 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145260 Rosetta Predictions human pricing
NM_001106716 Rosetta Predictions rat pricing
NM_011859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142950 predicted 388
2 SASI_Hs01_00142951 predicted 480
3 SASI_Hs02_00365122 predicted 958
4 SASI_Hs01_00142952 predicted 637
5 SASI_Hs01_00142953 predicted 847
6 SASI_Hs01_00142954 predicted 1086
7 SASI_Hs01_00142955 predicted 1082
8 SASI_Hs02_00365123 predicted 1011
9 SASI_Hs01_00142956 predicted 956
10 SASI_Hs01_00142957 predicted 856
11 SASI_Hs01_00142958 predicted 576
12 SASI_Hs01_00142959 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221688 predicted 599
2 SASI_Rn02_00221689 predicted 317
3 SASI_Rn02_00221690 predicted 705
4 SASI_Rn02_00221691 predicted 231
5 SASI_Rn02_00221692 predicted 829
6 SASI_Rn02_00221693 predicted 688
7 SASI_Rn02_00221694 predicted 774
8 SASI_Rn02_00221695 predicted 590
9 SASI_Rn02_00221696 predicted 829
10 SASI_Rn02_00221697 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191610 predicted 625
2 SASI_Mm01_00191611 predicted 474
3 SASI_Mm01_00191612 predicted 837
4 SASI_Mm01_00191613 predicted 417
5 SASI_Mm01_00191614 predicted 807
6 SASI_Mm01_00191615 predicted 1016
7 SASI_Mm01_00191616 predicted 1065
8 SASI_Mm01_00191617 predicted 847
9 SASI_Mm01_00191618 predicted 325
10 SASI_Mm01_00191619 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145260
OSR1 MISSION shRNA Bacterial Glycerol Stock
odd-skipped related 1 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145260.1-963s1c1
Sequence:CCGGCCACAGATATATTCACTCCAACTCGAGTTGGAGTGAATATATCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145260.1-858s1c1
Sequence:CCGGCAAGTCCTACAACCTACTTATCTCGAGATAAGTAGGTTGTAGGACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145260.1-423s1c1
Sequence:CCGGCCTGTATGGTTTCAGCGCGTTCTCGAGAACGCGCTGAAACCATACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145260.2-1468s21c1
Sequence:CCGGTTGACCATATAAGCTTGTAACCTCGAGGTTACAAGCTTATATGGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145260.2-1349s21c1
Sequence:CCGGGCGGAAGGGAAACTGCATTAACTCGAGTTAATGCAGTTTCCCTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145260
OSR1 MISSION shRNA shRNA Plasmid DNA
odd-skipped related 1 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145260.1-963s1c1
Sequence:CCGGCCACAGATATATTCACTCCAACTCGAGTTGGAGTGAATATATCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145260.1-858s1c1
Sequence:CCGGCAAGTCCTACAACCTACTTATCTCGAGATAAGTAGGTTGTAGGACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145260.1-423s1c1
Sequence:CCGGCCTGTATGGTTTCAGCGCGTTCTCGAGAACGCGCTGAAACCATACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145260.2-1468s21c1
Sequence:CCGGTTGACCATATAAGCTTGTAACCTCGAGGTTACAAGCTTATATGGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145260.2-1349s21c1
Sequence:CCGGGCGGAAGGGAAACTGCATTAACTCGAGTTAATGCAGTTTCCCTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145260
OSR1 MISSION shRNA Lentiviral Transduction Particles
odd-skipped related 1 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145260.1-963s1c1
Sequence:CCGGCCACAGATATATTCACTCCAACTCGAGTTGGAGTGAATATATCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145260.1-858s1c1
Sequence:CCGGCAAGTCCTACAACCTACTTATCTCGAGATAAGTAGGTTGTAGGACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145260.1-423s1c1
Sequence:CCGGCCTGTATGGTTTCAGCGCGTTCTCGAGAACGCGCTGAAACCATACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145260.2-1468s21c1
Sequence:CCGGTTGACCATATAAGCTTGTAACCTCGAGGTTACAAGCTTATATGGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145260.2-1349s21c1
Sequence:CCGGGCGGAAGGGAAACTGCATTAACTCGAGTTAATGCAGTTTCCCTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011859
VALIDATED
OSR1 MISSION shRNA Bacterial Glycerol Stock
odd-skipped related 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-1202s1c1
Sequence:CCGGTCTTCCTTCCACAGCAACAAACTCGAGTTTGTTGCTGTGGAAGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011859.2-343s1c1
Sequence:CCGGCTTACCAATTACTCTTTCCTTCTCGAGAAGGAAAGAGTAATTGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-836s1c1
Sequence:CCGGGCCACTTCACTAAGTCCTATACTCGAGTATAGGACTTAGTGAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-845s1c1
Sequence:CCGGCTAAGTCCTATAACCTACTTACTCGAGTAAGTAGGTTATAGGACTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-633s1c1
Sequence:CCGGGCCTCGCTTTGATTTCGCTAACTCGAGTTAGCGAAATCAAAGCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-845s21c1
Sequence:CCGGCTAAGTCCTATAACCTACTTACTCGAGTAAGTAGGTTATAGGACTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-1076s21c1
Sequence:CCGGCCAAGATCAAATGCTAAATAACTCGAGTTATTTAGCATTTGATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011859.2-1140s21c1
Sequence:CCGGTTCTCTACCAGAGGGACCCAACTCGAGTTGGGTCCCTCTGGTAGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-943s21c1
Sequence:CCGGCTACGGGACCACAGATATATTCTCGAGAATATATCTGTGGTCCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-414s21c1
Sequence:CCGGGTATGGTTTCAGCGCTCTTCACTCGAGTGAAGAGCGCTGAAACCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011859
VALIDATED
OSR1 MISSION shRNA shRNA Plasmid DNA
odd-skipped related 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-1202s1c1
Sequence:CCGGTCTTCCTTCCACAGCAACAAACTCGAGTTTGTTGCTGTGGAAGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011859.2-343s1c1
Sequence:CCGGCTTACCAATTACTCTTTCCTTCTCGAGAAGGAAAGAGTAATTGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-836s1c1
Sequence:CCGGGCCACTTCACTAAGTCCTATACTCGAGTATAGGACTTAGTGAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-845s1c1
Sequence:CCGGCTAAGTCCTATAACCTACTTACTCGAGTAAGTAGGTTATAGGACTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-633s1c1
Sequence:CCGGGCCTCGCTTTGATTTCGCTAACTCGAGTTAGCGAAATCAAAGCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-845s21c1
Sequence:CCGGCTAAGTCCTATAACCTACTTACTCGAGTAAGTAGGTTATAGGACTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-1076s21c1
Sequence:CCGGCCAAGATCAAATGCTAAATAACTCGAGTTATTTAGCATTTGATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011859.2-1140s21c1
Sequence:CCGGTTCTCTACCAGAGGGACCCAACTCGAGTTGGGTCCCTCTGGTAGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-943s21c1
Sequence:CCGGCTACGGGACCACAGATATATTCTCGAGAATATATCTGTGGTCCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-414s21c1
Sequence:CCGGGTATGGTTTCAGCGCTCTTCACTCGAGTGAAGAGCGCTGAAACCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011859
VALIDATED
OSR1 MISSION shRNA Lentiviral Transduction Particles
odd-skipped related 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-1202s1c1
Sequence:CCGGTCTTCCTTCCACAGCAACAAACTCGAGTTTGTTGCTGTGGAAGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011859.2-343s1c1
Sequence:CCGGCTTACCAATTACTCTTTCCTTCTCGAGAAGGAAAGAGTAATTGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-836s1c1
Sequence:CCGGGCCACTTCACTAAGTCCTATACTCGAGTATAGGACTTAGTGAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-845s1c1
Sequence:CCGGCTAAGTCCTATAACCTACTTACTCGAGTAAGTAGGTTATAGGACTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011859.2-633s1c1
Sequence:CCGGGCCTCGCTTTGATTTCGCTAACTCGAGTTAGCGAAATCAAAGCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-845s21c1
Sequence:CCGGCTAAGTCCTATAACCTACTTACTCGAGTAAGTAGGTTATAGGACTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-1076s21c1
Sequence:CCGGCCAAGATCAAATGCTAAATAACTCGAGTTATTTAGCATTTGATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011859.2-1140s21c1
Sequence:CCGGTTCTCTACCAGAGGGACCCAACTCGAGTTGGGTCCCTCTGGTAGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-943s21c1
Sequence:CCGGCTACGGGACCACAGATATATTCTCGAGAATATATCTGTGGTCCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011859.2-414s21c1
Sequence:CCGGGTATGGTTTCAGCGCTCTTCACTCGAGTGAAGAGCGCTGAAACCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)