EMAIL THIS PAGE TO A FRIEND

OSTC

oligosaccharyltransferase complex subunit (non-catalytic)

44 Gene Product Result for
UniProtKB ID: Q9NRP0, A8MYS2, B2R5H1, D6RH22, Q9P075, Q9P1R4
Gene ID:
Mouse(66357) oligosaccharyltransferase complex subunit
Rat(362040) oligosaccharyltransferase complex subunit (non-catalytic)
Zebrafish(393239) oligosaccharyltransferase complex subunit
cow(768033) oligosaccharyltransferase complex subunit
domestic cat(101089606) oligosaccharyltransferase complex subunit
dog(477512) oligosaccharyltransferase complex subunit
chicken(422525) oligosaccharyltransferase complex subunit
naked mole-rat(101710061) oligosaccharyltransferase complex subunit (non-catalytic)
domestic guinea pig(100716987) oligosaccharyltransferase complex subunit (non-catalytic)
sheep(101121263) oligosaccharyltransferase complex subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021227 Rosetta Predictions human pricing
NM_001108566 Rosetta Predictions rat pricing
NM_025509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040419 predicted 232
2 SASI_Hs01_00040420 predicted 430
3 SASI_Hs01_00040421 predicted 241
4 SASI_Hs01_00040422 predicted 230
5 SASI_Hs01_00040423 predicted 436
6 SASI_Hs02_00354849 predicted 303
7 SASI_Hs01_00040424 predicted 70
8 SASI_Hs01_00040425 predicted 193
9 SASI_Hs02_00354850 predicted 531
10 SASI_Hs01_00040426 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239899 predicted 246
2 SASI_Rn02_00239900 predicted 532
3 SASI_Rn02_00239901 predicted 335
4 SASI_Rn02_00239902 predicted 657
5 SASI_Rn02_00239903 predicted 326
6 SASI_Rn02_00239904 predicted 644
7 SASI_Rn02_00239905 predicted 454
8 SASI_Rn02_00239906 predicted 597
9 SASI_Rn02_00239907 predicted 414
10 SASI_Rn02_00239908 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135060 predicted 248
2 SASI_Mm01_00135061 predicted 355
3 SASI_Mm01_00135062 predicted 327
4 SASI_Mm01_00135063 predicted 401
5 SASI_Mm01_00135064 predicted 657
6 SASI_Mm01_00135065 predicted 270
7 SASI_Mm01_00135066 predicted 437
8 SASI_Mm01_00135067 predicted 707
9 SASI_Mm01_00135068 predicted 330
10 SASI_Mm01_00135069 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021227
OSTC MISSION shRNA Bacterial Glycerol Stock
oligosaccharyltransferase complex subunit (non-catalytic)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-297s1c1
Sequence:CCGGGCCTACAGAGTAAATGGACAACTCGAGTTGTCCATTTACTCTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-391s1c1
Sequence:CCGGCGAATGCACCAAATATCCCAACTCGAGTTGGGATATTTGGTGCATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021227.2-751s1c1
Sequence:CCGGCCAATGATGTTGAGTGGCATTCTCGAGAATGCCACTCAACATCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-370s1c1
Sequence:CCGGGTTTCATAATCCTGGACCGATCTCGAGATCGGTCCAGGATTATGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021227.2-582s1c1
Sequence:CCGGGCTGTACCAATCCTCTAATATCTCGAGATATTAGAGGATTGGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-222s1c1
Sequence:CCGGGATGTTATTGTTGAACCTCCACTCGAGTGGAGGTTCAACAATAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-298s1c1
Sequence:CCGGCCTACAGAGTAAATGGACAATCTCGAGATTGTCCATTTACTCTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021227.2-946s1c1
Sequence:CCGGCAGCTTTACCTATGGTGCTTTCTCGAGAAAGCACCATAGGTAAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-246s1c1
Sequence:CCGGGTCGGTTCTATGACTGATGAACTCGAGTTCATCAGTCATAGAACCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021227
OSTC MISSION shRNA shRNA Plasmid DNA
oligosaccharyltransferase complex subunit (non-catalytic)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-297s1c1
Sequence:CCGGGCCTACAGAGTAAATGGACAACTCGAGTTGTCCATTTACTCTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-391s1c1
Sequence:CCGGCGAATGCACCAAATATCCCAACTCGAGTTGGGATATTTGGTGCATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021227.2-751s1c1
Sequence:CCGGCCAATGATGTTGAGTGGCATTCTCGAGAATGCCACTCAACATCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-370s1c1
Sequence:CCGGGTTTCATAATCCTGGACCGATCTCGAGATCGGTCCAGGATTATGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021227.2-582s1c1
Sequence:CCGGGCTGTACCAATCCTCTAATATCTCGAGATATTAGAGGATTGGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-222s1c1
Sequence:CCGGGATGTTATTGTTGAACCTCCACTCGAGTGGAGGTTCAACAATAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-298s1c1
Sequence:CCGGCCTACAGAGTAAATGGACAATCTCGAGATTGTCCATTTACTCTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021227.2-946s1c1
Sequence:CCGGCAGCTTTACCTATGGTGCTTTCTCGAGAAAGCACCATAGGTAAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-246s1c1
Sequence:CCGGGTCGGTTCTATGACTGATGAACTCGAGTTCATCAGTCATAGAACCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021227
OSTC MISSION shRNA Lentiviral Transduction Particles
oligosaccharyltransferase complex subunit (non-catalytic)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-297s1c1
Sequence:CCGGGCCTACAGAGTAAATGGACAACTCGAGTTGTCCATTTACTCTGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-391s1c1
Sequence:CCGGCGAATGCACCAAATATCCCAACTCGAGTTGGGATATTTGGTGCATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021227.2-751s1c1
Sequence:CCGGCCAATGATGTTGAGTGGCATTCTCGAGAATGCCACTCAACATCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-370s1c1
Sequence:CCGGGTTTCATAATCCTGGACCGATCTCGAGATCGGTCCAGGATTATGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021227.2-582s1c1
Sequence:CCGGGCTGTACCAATCCTCTAATATCTCGAGATATTAGAGGATTGGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-222s1c1
Sequence:CCGGGATGTTATTGTTGAACCTCCACTCGAGTGGAGGTTCAACAATAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-298s1c1
Sequence:CCGGCCTACAGAGTAAATGGACAATCTCGAGATTGTCCATTTACTCTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021227.2-946s1c1
Sequence:CCGGCAGCTTTACCTATGGTGCTTTCTCGAGAAAGCACCATAGGTAAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021227.2-246s1c1
Sequence:CCGGGTCGGTTCTATGACTGATGAACTCGAGTTCATCAGTCATAGAACCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025509
VALIDATED
OSTC MISSION shRNA Bacterial Glycerol Stock
oligosaccharyltransferase complex subunit (non-catalytic)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025509.2-520s1c1
Sequence:CCGGCCCGGATTTGCTCCTGTTAATCTCGAGATTAACAGGAGCAAATCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-520s21c1
Sequence:CCGGCCCGGATTTGCTCCTGTTAATCTCGAGATTAACAGGAGCAAATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-273s21c1
Sequence:CCGGACAGAGTAAACGGACAGTATACTCGAGTATACTGTCCGTTTACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025509.2-244s1c1
Sequence:CCGGGCATCAGAGACCAGTAGCTTTCTCGAGAAAGCTACTGGTCTCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025509.2-376s1c1
Sequence:CCGGCATACCGAAACTCAACAGGTTCTCGAGAACCTGTTGAGTTTCGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025509.2-703s1c1
Sequence:CCGGCCAGTGTACCAGCTATGTTAACTCGAGTTAACATAGCTGGTACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-703s21c1
Sequence:CCGGCCAGTGTACCAGCTATGTTAACTCGAGTTAACATAGCTGGTACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-321s21c1
Sequence:CCGGTCTTTACAATGGGAGGTTTAGCTCGAGCTAAACCTCCCATTGTAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-244s21c1
Sequence:CCGGGCATCAGAGACCAGTAGCTTTCTCGAGAAAGCTACTGGTCTCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025509
VALIDATED
OSTC MISSION shRNA shRNA Plasmid DNA
oligosaccharyltransferase complex subunit (non-catalytic)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025509.2-520s1c1
Sequence:CCGGCCCGGATTTGCTCCTGTTAATCTCGAGATTAACAGGAGCAAATCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-520s21c1
Sequence:CCGGCCCGGATTTGCTCCTGTTAATCTCGAGATTAACAGGAGCAAATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-273s21c1
Sequence:CCGGACAGAGTAAACGGACAGTATACTCGAGTATACTGTCCGTTTACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025509.2-244s1c1
Sequence:CCGGGCATCAGAGACCAGTAGCTTTCTCGAGAAAGCTACTGGTCTCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025509.2-376s1c1
Sequence:CCGGCATACCGAAACTCAACAGGTTCTCGAGAACCTGTTGAGTTTCGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025509.2-703s1c1
Sequence:CCGGCCAGTGTACCAGCTATGTTAACTCGAGTTAACATAGCTGGTACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-703s21c1
Sequence:CCGGCCAGTGTACCAGCTATGTTAACTCGAGTTAACATAGCTGGTACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-321s21c1
Sequence:CCGGTCTTTACAATGGGAGGTTTAGCTCGAGCTAAACCTCCCATTGTAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-244s21c1
Sequence:CCGGGCATCAGAGACCAGTAGCTTTCTCGAGAAAGCTACTGGTCTCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025509
VALIDATED
OSTC MISSION shRNA Lentiviral Transduction Particles
oligosaccharyltransferase complex subunit (non-catalytic)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025509.2-520s1c1
Sequence:CCGGCCCGGATTTGCTCCTGTTAATCTCGAGATTAACAGGAGCAAATCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-520s21c1
Sequence:CCGGCCCGGATTTGCTCCTGTTAATCTCGAGATTAACAGGAGCAAATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-273s21c1
Sequence:CCGGACAGAGTAAACGGACAGTATACTCGAGTATACTGTCCGTTTACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025509.2-244s1c1
Sequence:CCGGGCATCAGAGACCAGTAGCTTTCTCGAGAAAGCTACTGGTCTCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025509.2-376s1c1
Sequence:CCGGCATACCGAAACTCAACAGGTTCTCGAGAACCTGTTGAGTTTCGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025509.2-703s1c1
Sequence:CCGGCCAGTGTACCAGCTATGTTAACTCGAGTTAACATAGCTGGTACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-703s21c1
Sequence:CCGGCCAGTGTACCAGCTATGTTAACTCGAGTTAACATAGCTGGTACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-321s21c1
Sequence:CCGGTCTTTACAATGGGAGGTTTAGCTCGAGCTAAACCTCCCATTGTAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025509.2-244s21c1
Sequence:CCGGGCATCAGAGACCAGTAGCTTTCTCGAGAAAGCTACTGGTCTCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)