EMAIL THIS PAGE TO A FRIEND

OSTCP1

oligosaccharyltransferase complex subunit pseudogene 1

11 Gene Product Result for
Synonyms: DC2L OSTCL
Species: Human OSTCP1(202459)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145303 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128771 MISSION® esiRNA esiRNA human OSTCL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145303 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179225 predicted 500
2 SASI_Hs01_00179226 predicted 373
3 SASI_Hs02_00365195 predicted 404
4 SASI_Hs02_00365196 predicted 419
5 SASI_Hs01_00179227 predicted 373
6 SASI_Hs01_00179228 predicted 518
7 SASI_Hs01_00179229 predicted 631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145303
OSTCP1 MISSION shRNA Bacterial Glycerol Stock
oligosaccharyltransferase complex subunit pseudogene 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-521s1c1
Sequence:CCGGGTTTGTGTCCTATTGAGCTTTCTCGAGAAAGCTCAATAGGACACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-296s1c1
Sequence:CCGGGATGTTATTGTTGAACCTCCACTCGAGTGGAGGTTCAACAATAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-421s1c1
Sequence:CCGGCCTGTTTACAATAGGAGGTTTCTCGAGAAACCTCCTATTGTAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-444s1c1
Sequence:CCGGGTTTCATATTCCTGGACCGATCTCGAGATCGGTCCAGGAATATGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-371s1c1
Sequence:CCGGGCCAACAGAGTAAATGAACAACTCGAGTTGTTCATTTACTCTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-410s1c1
Sequence:CCGGGCATCCAGCTTCCTGTTTACACTCGAGTGTAAACAGGAAGCTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-466s1c1
Sequence:CCGGGAATGCACCAAATATCCCAAACTCGAGTTTGGGATATTTGGTGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145303.1-665s1c1
Sequence:CCGGGCTCCTGTCAATGAAGTTTAACTCGAGTTAAACTTCATTGACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145303
OSTCP1 MISSION shRNA shRNA Plasmid DNA
oligosaccharyltransferase complex subunit pseudogene 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-521s1c1
Sequence:CCGGGTTTGTGTCCTATTGAGCTTTCTCGAGAAAGCTCAATAGGACACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-296s1c1
Sequence:CCGGGATGTTATTGTTGAACCTCCACTCGAGTGGAGGTTCAACAATAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-421s1c1
Sequence:CCGGCCTGTTTACAATAGGAGGTTTCTCGAGAAACCTCCTATTGTAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-444s1c1
Sequence:CCGGGTTTCATATTCCTGGACCGATCTCGAGATCGGTCCAGGAATATGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-371s1c1
Sequence:CCGGGCCAACAGAGTAAATGAACAACTCGAGTTGTTCATTTACTCTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-410s1c1
Sequence:CCGGGCATCCAGCTTCCTGTTTACACTCGAGTGTAAACAGGAAGCTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-466s1c1
Sequence:CCGGGAATGCACCAAATATCCCAAACTCGAGTTTGGGATATTTGGTGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145303.1-665s1c1
Sequence:CCGGGCTCCTGTCAATGAAGTTTAACTCGAGTTAAACTTCATTGACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145303
OSTCP1 MISSION shRNA Lentiviral Transduction Particles
oligosaccharyltransferase complex subunit pseudogene 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-521s1c1
Sequence:CCGGGTTTGTGTCCTATTGAGCTTTCTCGAGAAAGCTCAATAGGACACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-296s1c1
Sequence:CCGGGATGTTATTGTTGAACCTCCACTCGAGTGGAGGTTCAACAATAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-421s1c1
Sequence:CCGGCCTGTTTACAATAGGAGGTTTCTCGAGAAACCTCCTATTGTAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-444s1c1
Sequence:CCGGGTTTCATATTCCTGGACCGATCTCGAGATCGGTCCAGGAATATGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-371s1c1
Sequence:CCGGGCCAACAGAGTAAATGAACAACTCGAGTTGTTCATTTACTCTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-410s1c1
Sequence:CCGGGCATCCAGCTTCCTGTTTACACTCGAGTGTAAACAGGAAGCTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145303.1-466s1c1
Sequence:CCGGGAATGCACCAAATATCCCAAACTCGAGTTTGGGATATTTGGTGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145303.1-665s1c1
Sequence:CCGGGCTCCTGTCAATGAAGTTTAACTCGAGTTAAACTTCATTGACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)