EMAIL THIS PAGE TO A FRIEND

OSTF1

osteoclast stimulating factor 1

71 Gene Product Result for
Synonyms: OSF SH3P2 bA235O14.1
UniProtKB ID: Q92882, Q5W126, Q96IJ4
Gene ID:
Human(26578) Summary: Osteoclast-stimulating factor-1 is an intracellular protein produced by osteoclasts that indirectly induces osteoclast formation and bone resorption (Reddy et al., 1998 [PubMed 10092216]
Mouse(20409) osteoclast stimulating factor 1
Rat(259275) osteoclast stimulating factor 1
Zebrafish(405783) osteoclast stimulating factor 1
dog(484161) osteoclast stimulating factor 1
cow(281961) osteoclast stimulating factor 1
domestic cat(101093213) osteoclast stimulating factor 1
chicken(427258) osteoclast stimulating factor 1
sheep(101122078) osteoclast stimulating factor 1
domestic guinea pig(100712659) osteoclast stimulating factor 1
naked mole-rat(101710526) osteoclast stimulating factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105804 Anti-OSTF1 (187-200) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105803 Anti-OSTF1 (21-35) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4200323 Anti-OSTF1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
western blot pricing
SAB4200322 Anti-OSTF1 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunoprecipitation (IP), western blot pricing
SAB1400492 Anti-OSTF1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1409099 Anti-OSTF1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA020514 Anti-OSTF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200092 Monoclonal Anti-OSTF1 antibody produced in mouse ~1.5 mg/mL, clone OSTF21, purified immunoglobulin human, monkey, bovine, mouse, rat
immunofluorescence, western blot pricing
SAB4200122 Monoclonal Anti-OSTF1 antibody produced in mouse ~1.5 mg/mL, clone OSTF1, affinity isolated antibody bovine, mouse, monkey, canine, human, rat
western blot pricing
SAB1401632 Monoclonal Anti-OSTF1 antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012383 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012383 Rosetta Predictions human pricing
NM_148892 Rosetta Predictions rat pricing
NM_017375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344179 predicted 231
2 SASI_Hs01_00030400 predicted 391
3 SASI_Hs02_00344180 predicted 575
4 SASI_Hs02_00344181 predicted 330
5 SASI_Hs01_00030402 predicted 614
6 SASI_Hs02_00344182 predicted 495
7 SASI_Hs01_00030408 predicted 378
8 SASI_Hs02_00344183 predicted 562
9 SASI_Hs02_00344184 predicted 835
10 SASI_Hs02_00344185 predicted 413
11 SASI_Hs01_00030399 predicted 323
12 SASI_Hs01_00030401 predicted 260
13 SASI_Hs01_00030403 predicted 233
14 SASI_Hs01_00030404 predicted 672
15 SASI_Hs01_00030405 predicted 679
16 SASI_Hs01_00030406 predicted 464
17 SASI_Hs01_00030407 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075600 predicted 483
2 SASI_Rn01_00075601 predicted 204
3 SASI_Rn01_00075602 predicted 208
4 SASI_Rn01_00075603 predicted 745
5 SASI_Rn01_00075606 predicted 305
6 SASI_Rn01_00075607 predicted 482
7 SASI_Rn01_00075608 predicted 474
8 SASI_Rn01_00075609 predicted 353
9 SASI_Rn02_00268898 predicted 784
10 SASI_Rn02_00268899 predicted 577
11 SASI_Rn01_00075604 predicted 231
12 SASI_Rn01_00075605 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023699 predicted 455
2 SASI_Mm01_00023700 predicted 398
3 SASI_Mm01_00023701 predicted 226
4 SASI_Mm01_00023702 predicted 496
5 SASI_Mm02_00323862 predicted 231
6 SASI_Mm01_00023703 predicted 339
7 SASI_Mm01_00023704 predicted 334
8 SASI_Mm01_00023705 predicted 267
9 SASI_Mm01_00023706 predicted 782
10 SASI_Mm01_00023707 predicted 602
11 SASI_Mm01_00023708 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012383
OSTF1 MISSION shRNA Bacterial Glycerol Stock
osteoclast stimulating factor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-320s1c1
Sequence:CCGGGACTGGACTAATTCCAAGCAACTCGAGTTGCTTGGAATTAGTCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012383.4-982s21c1
Sequence:CCGGGTTTGAGTAGAACGTGTAAATCTCGAGATTTACACGTTCTACTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-748s1c1
Sequence:CCGGCATTAAGCAATGCCGAGGACTCTCGAGAGTCCTCGGCATTGCTTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-222s1c1
Sequence:CCGGCCCAGAACTCCAGATGAATTACTCGAGTAATTCATCTGGAGTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-451s1c1
Sequence:CCGGGCTTAGACAAAGCTGGAAGCACTCGAGTGCTTCCAGCTTTGTCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-552s1c1
Sequence:CCGGCAGCAGAACAAGTTGGGAGATCTCGAGATCTCCCAACTTGTTCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012383.4-838s21c1
Sequence:CCGGTGATGAAGACTCAGATTAATTCTCGAGAATTAATCTGAGTCTTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012383
OSTF1 MISSION shRNA shRNA Plasmid DNA
osteoclast stimulating factor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-320s1c1
Sequence:CCGGGACTGGACTAATTCCAAGCAACTCGAGTTGCTTGGAATTAGTCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012383.4-982s21c1
Sequence:CCGGGTTTGAGTAGAACGTGTAAATCTCGAGATTTACACGTTCTACTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-748s1c1
Sequence:CCGGCATTAAGCAATGCCGAGGACTCTCGAGAGTCCTCGGCATTGCTTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-222s1c1
Sequence:CCGGCCCAGAACTCCAGATGAATTACTCGAGTAATTCATCTGGAGTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-451s1c1
Sequence:CCGGGCTTAGACAAAGCTGGAAGCACTCGAGTGCTTCCAGCTTTGTCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-552s1c1
Sequence:CCGGCAGCAGAACAAGTTGGGAGATCTCGAGATCTCCCAACTTGTTCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012383.4-838s21c1
Sequence:CCGGTGATGAAGACTCAGATTAATTCTCGAGAATTAATCTGAGTCTTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012383
OSTF1 MISSION shRNA Lentiviral Transduction Particles
osteoclast stimulating factor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-320s1c1
Sequence:CCGGGACTGGACTAATTCCAAGCAACTCGAGTTGCTTGGAATTAGTCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012383.4-982s21c1
Sequence:CCGGGTTTGAGTAGAACGTGTAAATCTCGAGATTTACACGTTCTACTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-748s1c1
Sequence:CCGGCATTAAGCAATGCCGAGGACTCTCGAGAGTCCTCGGCATTGCTTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-222s1c1
Sequence:CCGGCCCAGAACTCCAGATGAATTACTCGAGTAATTCATCTGGAGTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-451s1c1
Sequence:CCGGGCTTAGACAAAGCTGGAAGCACTCGAGTGCTTCCAGCTTTGTCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012383.3-552s1c1
Sequence:CCGGCAGCAGAACAAGTTGGGAGATCTCGAGATCTCCCAACTTGTTCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012383.4-838s21c1
Sequence:CCGGTGATGAAGACTCAGATTAATTCTCGAGAATTAATCTGAGTCTTCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017375
OSTF1 MISSION shRNA Bacterial Glycerol Stock
osteoclast stimulating factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-365s1c1
Sequence:CCGGCAGAATCCATTGACAATCCATCTCGAGATGGATTGTCAATGGATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017375.3-530s21c1
Sequence:CCGGGTTCTGTTTACTCAGCCGAATCTCGAGATTCGGCTGAGTAAACAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017375.1-816s1c1
Sequence:CCGGGCCGCTTTGATTGTTGCCTAACTCGAGTTAGGCAACAATCAAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-526s1c1
Sequence:CCGGGTTCTGTTTACTCAGCCGAATCTCGAGATTCGGCTGAGTAAACAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-364s1c1
Sequence:CCGGGCAGAATCCATTGACAATCCACTCGAGTGGATTGTCAATGGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-226s1c1
Sequence:CCGGGAACCCAGAACTCCAGATGAACTCGAGTTCATCTGGAGTTCTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017375.3-368s21c1
Sequence:CCGGGCAGAATCCATTGACAATCCACTCGAGTGGATTGTCAATGGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017375.3-230s21c1
Sequence:CCGGGAACCCAGAACTCCAGATGAACTCGAGTTCATCTGGAGTTCTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017375.3-820s21c1
Sequence:CCGGGCCGCTTTGATTGTTGCCTAACTCGAGTTAGGCAACAATCAAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017375
OSTF1 MISSION shRNA shRNA Plasmid DNA
osteoclast stimulating factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-365s1c1
Sequence:CCGGCAGAATCCATTGACAATCCATCTCGAGATGGATTGTCAATGGATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017375.3-530s21c1
Sequence:CCGGGTTCTGTTTACTCAGCCGAATCTCGAGATTCGGCTGAGTAAACAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017375.1-816s1c1
Sequence:CCGGGCCGCTTTGATTGTTGCCTAACTCGAGTTAGGCAACAATCAAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-526s1c1
Sequence:CCGGGTTCTGTTTACTCAGCCGAATCTCGAGATTCGGCTGAGTAAACAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-364s1c1
Sequence:CCGGGCAGAATCCATTGACAATCCACTCGAGTGGATTGTCAATGGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-226s1c1
Sequence:CCGGGAACCCAGAACTCCAGATGAACTCGAGTTCATCTGGAGTTCTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017375.3-368s21c1
Sequence:CCGGGCAGAATCCATTGACAATCCACTCGAGTGGATTGTCAATGGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017375.3-230s21c1
Sequence:CCGGGAACCCAGAACTCCAGATGAACTCGAGTTCATCTGGAGTTCTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017375.3-820s21c1
Sequence:CCGGGCCGCTTTGATTGTTGCCTAACTCGAGTTAGGCAACAATCAAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017375
OSTF1 MISSION shRNA Lentiviral Transduction Particles
osteoclast stimulating factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-365s1c1
Sequence:CCGGCAGAATCCATTGACAATCCATCTCGAGATGGATTGTCAATGGATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017375.3-530s21c1
Sequence:CCGGGTTCTGTTTACTCAGCCGAATCTCGAGATTCGGCTGAGTAAACAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017375.1-816s1c1
Sequence:CCGGGCCGCTTTGATTGTTGCCTAACTCGAGTTAGGCAACAATCAAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-526s1c1
Sequence:CCGGGTTCTGTTTACTCAGCCGAATCTCGAGATTCGGCTGAGTAAACAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-364s1c1
Sequence:CCGGGCAGAATCCATTGACAATCCACTCGAGTGGATTGTCAATGGATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017375.1-226s1c1
Sequence:CCGGGAACCCAGAACTCCAGATGAACTCGAGTTCATCTGGAGTTCTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017375.3-368s21c1
Sequence:CCGGGCAGAATCCATTGACAATCCACTCGAGTGGATTGTCAATGGATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017375.3-230s21c1
Sequence:CCGGGAACCCAGAACTCCAGATGAACTCGAGTTCATCTGGAGTTCTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017375.3-820s21c1
Sequence:CCGGGCCGCTTTGATTGTTGCCTAACTCGAGTTAGGCAACAATCAAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)