EMAIL THIS PAGE TO A FRIEND

OTC

ornithine carbamoyltransferase

54 Gene Product Result for
Synonyms: OCTD
UniProtKB ID: P00480, A8K9P2, D3DWB0, Q3KNR1, Q6B0I1, Q9NYJ5
Gene ID:
Human(5009) Summary: This nuclear gene encodes a mitochondrial matrix enzyme. Missense, nonsense, and frameshift mutations in this enzyme lead to ornithine transcarbamylase deficiency, which causes hyperammonemia. Since the gene for this enzyme maps close to that for Duchenne muscular dystrophy, it may play a role in that disease also. [provided by RefSeq, Jul 2008]
Mouse(18416) ornithine transcarbamylase
Rat(25611) ornithine carbamoyltransferase
Thale Cress(843869) ornithine carbamoyltransferase
Horse(100050268) ornithine carbamoyltransferase
cow(280887) ornithine carbamoyltransferase
domestic cat(101087817) ornithine carbamoyltransferase
Zebrafish(794667) ornithine carbamoyltransferase
chicken(395735) ornithine carbamoyltransferase
dog(480878) ornithine carbamoyltransferase
naked mole-rat(101706852) ornithine carbamoyltransferase
domestic guinea pig(100719416) ornithine carbamoyltransferase
Goat(100860880) ornithine carbamoyltransferase
sheep(101102207) ornithine carbamoyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154231 MISSION® esiRNA esiRNA human OTC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000531 Rosetta Predictions human pricing
NM_013078 Rosetta Predictions rat pricing
NM_008769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016686 predicted 629
2 SASI_Hs02_00302740 predicted 1369
3 SASI_Hs02_00302741 predicted 1277
4 SASI_Hs02_00302742 predicted 419
5 SASI_Hs01_00016688 predicted 1069
6 SASI_Hs01_00016689 predicted 700
7 SASI_Hs01_00016690 predicted 876
8 SASI_Hs01_00016691 predicted 767
9 SASI_Hs01_00016692 predicted 620
10 SASI_Hs01_00016693 predicted 235
11 SASI_Hs01_00016687 predicted 1025
12 SASI_Hs01_00016694 predicted 1362
13 SASI_Hs01_00016695 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088162 predicted 440
2 SASI_Rn01_00088163 predicted 865
3 SASI_Rn01_00088164 predicted 882
4 SASI_Rn01_00088165 predicted 761
5 SASI_Rn01_00088166 predicted 282
6 SASI_Rn01_00088168 predicted 506
7 SASI_Rn02_00260841 predicted 307
8 SASI_Rn01_00088169 predicted 612
9 SASI_Rn01_00088170 predicted 334
10 SASI_Rn01_00088171 predicted 260
11 SASI_Rn01_00088167 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115545 predicted 841
2 SASI_Mm01_00115546 predicted 860
3 SASI_Mm01_00115547 predicted 739
4 SASI_Mm02_00314661 predicted 640
5 SASI_Mm01_00115548 predicted 735
6 SASI_Mm01_00115549 predicted 307
7 SASI_Mm01_00115550 predicted 733
8 SASI_Mm01_00115551 predicted 229
9 SASI_Mm01_00115552 predicted 309
10 SASI_Mm01_00115553 predicted 592
11 SASI_Mm01_00115554 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000531
OTC MISSION shRNA Bacterial Glycerol Stock
ornithine carbamoyltransferase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000531.5-674s21c1
Sequence:CCGGGAAGCATCCATCCCAATTATCCTCGAGGATAATTGGGATGGATGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000531.5-266s21c1
Sequence:CCGGCACAACTTCATGGTTCGAAATCTCGAGATTTCGAACCATGAAGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-1009s1c1
Sequence:CCGGCGAGTGTATAAACAATCAGATCTCGAGATCTGATTGTTTATACACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-705s1c1
Sequence:CCGGCCGTGACCTTCTCACTCTAAACTCGAGTTTAGAGTGAGAAGGTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-1077s1c1
Sequence:CCGGGTCAGATTTGTACCATCCTATCTCGAGATAGGATGGTACAAATCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-862s1c1
Sequence:CCGGCGAACAAGATTGTCTACAGAACTCGAGTTCTGTAGACAATCTTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-1320s1c1
Sequence:CCGGGTTGCTGACAAATGATCCATTCTCGAGAATGGATCATTTGTCAGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000531
OTC MISSION shRNA shRNA Plasmid DNA
ornithine carbamoyltransferase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000531.5-674s21c1
Sequence:CCGGGAAGCATCCATCCCAATTATCCTCGAGGATAATTGGGATGGATGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000531.5-266s21c1
Sequence:CCGGCACAACTTCATGGTTCGAAATCTCGAGATTTCGAACCATGAAGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-1009s1c1
Sequence:CCGGCGAGTGTATAAACAATCAGATCTCGAGATCTGATTGTTTATACACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-705s1c1
Sequence:CCGGCCGTGACCTTCTCACTCTAAACTCGAGTTTAGAGTGAGAAGGTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-1077s1c1
Sequence:CCGGGTCAGATTTGTACCATCCTATCTCGAGATAGGATGGTACAAATCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-862s1c1
Sequence:CCGGCGAACAAGATTGTCTACAGAACTCGAGTTCTGTAGACAATCTTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-1320s1c1
Sequence:CCGGGTTGCTGACAAATGATCCATTCTCGAGAATGGATCATTTGTCAGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000531
OTC MISSION shRNA Lentiviral Transduction Particles
ornithine carbamoyltransferase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000531.5-674s21c1
Sequence:CCGGGAAGCATCCATCCCAATTATCCTCGAGGATAATTGGGATGGATGCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000531.5-266s21c1
Sequence:CCGGCACAACTTCATGGTTCGAAATCTCGAGATTTCGAACCATGAAGTTGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000035099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-1009s1c1
Sequence:CCGGCGAGTGTATAAACAATCAGATCTCGAGATCTGATTGTTTATACACTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000035100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-705s1c1
Sequence:CCGGCCGTGACCTTCTCACTCTAAACTCGAGTTTAGAGTGAGAAGGTCACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000035103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-1077s1c1
Sequence:CCGGGTCAGATTTGTACCATCCTATCTCGAGATAGGATGGTACAAATCTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000035101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-862s1c1
Sequence:CCGGCGAACAAGATTGTCTACAGAACTCGAGTTCTGTAGACAATCTTGTTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000035102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000531.3-1320s1c1
Sequence:CCGGGTTGCTGACAAATGATCCATTCTCGAGAATGGATCATTTGTCAGCAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008769
OTC MISSION shRNA Bacterial Glycerol Stock
ornithine carbamoyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-751s1c1
Sequence:CCGGGCCAGATCCTAATATAGTCAACTCGAGTTGACTATATTAGGATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008769.2-1476s1c1
Sequence:CCGGGCTTACAATGTCTAAGTCATTCTCGAGAATGACTTAGACATTGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-755s1c1
Sequence:CCGGGATCCTAATATAGTCAAGCTACTCGAGTAGCTTGACTATATTAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-935s1c1
Sequence:CCGGGTTACGATGAAGACTGCCAAACTCGAGTTTGGCAGTCTTCATCGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-310s1c1
Sequence:CCGGGCAAGGGAAATCCTTAGGAATCTCGAGATTCCTAAGGATTTCCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008769
OTC MISSION shRNA shRNA Plasmid DNA
ornithine carbamoyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-751s1c1
Sequence:CCGGGCCAGATCCTAATATAGTCAACTCGAGTTGACTATATTAGGATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008769.2-1476s1c1
Sequence:CCGGGCTTACAATGTCTAAGTCATTCTCGAGAATGACTTAGACATTGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-755s1c1
Sequence:CCGGGATCCTAATATAGTCAAGCTACTCGAGTAGCTTGACTATATTAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-935s1c1
Sequence:CCGGGTTACGATGAAGACTGCCAAACTCGAGTTTGGCAGTCTTCATCGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-310s1c1
Sequence:CCGGGCAAGGGAAATCCTTAGGAATCTCGAGATTCCTAAGGATTTCCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008769
OTC MISSION shRNA Lentiviral Transduction Particles
ornithine carbamoyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-751s1c1
Sequence:CCGGGCCAGATCCTAATATAGTCAACTCGAGTTGACTATATTAGGATCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008769.2-1476s1c1
Sequence:CCGGGCTTACAATGTCTAAGTCATTCTCGAGAATGACTTAGACATTGTAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-755s1c1
Sequence:CCGGGATCCTAATATAGTCAAGCTACTCGAGTAGCTTGACTATATTAGGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-935s1c1
Sequence:CCGGGTTACGATGAAGACTGCCAAACTCGAGTTTGGCAGTCTTCATCGTAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008769.2-310s1c1
Sequence:CCGGGCAAGGGAAATCCTTAGGAATCTCGAGATTCCTAAGGATTTCCCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???