EMAIL THIS PAGE TO A FRIEND

OTOA

otoancorin

79 Gene Product Result for
Synonyms: CT108 DFNB22
Gene ID:
Human(146183) Summary: The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(246190) otoancorin
Rat(499260) otoancorin
sheep(101115596) otoancorin
chicken(416624) otoancorin
dog(608655) otoancorin
Horse(100068851) otoancorin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144672 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068201 MISSION® esiRNA esiRNA human OTOA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144672 Rosetta Predictions human pricing
NM_170664 Rosetta Predictions human pricing
XM_001079392 Rosetta Predictions rat pricing
XM_574553 Rosetta Predictions rat pricing
NM_139310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022592 predicted 2891
2 SASI_Hs01_00022593 predicted 3039
3 SASI_Hs01_00022594 predicted 1632
4 SASI_Hs01_00022595 predicted 2278
5 SASI_Hs01_00022596 predicted 1404
6 SASI_Hs02_00364568 predicted 1797
7 SASI_Hs01_00022597 predicted 1480
8 SASI_Hs02_00364569 predicted 3097
9 SASI_Hs01_00022598 predicted 2278
10 SASI_Hs01_00022599 predicted 2802
11 SASI_Hs01_00022600 predicted 2415
12 SASI_Hs01_00022601 predicted 1547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161729 predicted 1980
2 SASI_Hs01_00161730 predicted 2142
3 SASI_Hs01_00161731 predicted 725
4 SASI_Hs01_00161732 predicted 1368
5 SASI_Hs01_00161733 predicted 490
6 SASI_Hs02_00367572 predicted 890
7 SASI_Hs01_00161734 predicted 571
8 SASI_Hs02_00367573 predicted 2191
9 SASI_Hs01_00161735 predicted 1371
10 SASI_Hs01_00161736 predicted 1896
11 SASI_Hs01_00161737 predicted 1505
12 SASI_Hs01_00161738 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364234 predicted 2564
2 SASI_Rn02_00364235 predicted 1564
3 SASI_Rn02_00364236 predicted 2854
4 SASI_Rn02_00364237 predicted 2658
5 SASI_Rn02_00364238 predicted 993
6 SASI_Rn02_00364239 predicted 1743
7 SASI_Rn02_00364240 predicted 1625
8 SASI_Rn02_00364241 predicted 3069
9 SASI_Rn02_00364242 predicted 2192
10 SASI_Rn02_00364243 predicted 2561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402162 predicted 2565
2 SASI_Rn02_00402163 predicted 1564
3 SASI_Rn02_00402164 predicted 456
4 SASI_Rn02_00402165 predicted 2858
5 SASI_Rn02_00402166 predicted 2655
6 SASI_Rn02_00402167 predicted 988
7 SASI_Rn02_00402168 predicted 1743
8 SASI_Rn02_00402169 predicted 1627
9 SASI_Rn02_00402170 predicted 2189
10 SASI_Rn02_00402171 predicted 2557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068854 predicted 1648
2 SASI_Mm02_00340021 predicted 1623
3 SASI_Mm01_00068856 predicted 2685
4 SASI_Mm01_00068857 predicted 3163
5 SASI_Mm01_00068858 predicted 2452
6 SASI_Mm01_00068859 predicted 1510
7 SASI_Mm01_00068860 predicted 2346
8 SASI_Mm01_00068861 predicted 1877
9 SASI_Mm01_00068862 predicted 1869
10 SASI_Mm01_00068863 predicted 912
11 SASI_Mm01_00068855 predicted 2502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144672
OTOA MISSION shRNA Bacterial Glycerol Stock
otoancorin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-61s1c1
Sequence:CCGGGTCGAGTTATACAGTGCCAAACTCGAGTTTGGCACTGTATAACTCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144672.3-150s21c1
Sequence:CCGGATGCACTGCTGGATCTCATACCTCGAGGTATGAGATCCAGCAGTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-1862s1c1
Sequence:CCGGGCGTGGAAATACTGGGAAGTTCTCGAGAACTTCCCAGTATTTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-362s1c1
Sequence:CCGGGCCATGAAATGCCTCTTAGAACTCGAGTTCTAAGAGGCATTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-63s1c1
Sequence:CCGGCGAGTTATACAGTGCCAAATTCTCGAGAATTTGGCACTGTATAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-1673s1c1
Sequence:CCGGGCTCTGTTCCTGTATGAGCTTCTCGAGAAGCTCATACAGGAACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144672.3-756s21c1
Sequence:CCGGGGGTCAGTGCGGAACACTTATCTCGAGATAAGTGTTCCGCACTGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144672.3-1286s21c1
Sequence:CCGGATCATCTTGTCTGCCAAATACCTCGAGGTATTTGGCAGACAAGATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144672
OTOA MISSION shRNA shRNA Plasmid DNA
otoancorin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-61s1c1
Sequence:CCGGGTCGAGTTATACAGTGCCAAACTCGAGTTTGGCACTGTATAACTCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144672.3-150s21c1
Sequence:CCGGATGCACTGCTGGATCTCATACCTCGAGGTATGAGATCCAGCAGTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-1862s1c1
Sequence:CCGGGCGTGGAAATACTGGGAAGTTCTCGAGAACTTCCCAGTATTTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-362s1c1
Sequence:CCGGGCCATGAAATGCCTCTTAGAACTCGAGTTCTAAGAGGCATTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-63s1c1
Sequence:CCGGCGAGTTATACAGTGCCAAATTCTCGAGAATTTGGCACTGTATAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-1673s1c1
Sequence:CCGGGCTCTGTTCCTGTATGAGCTTCTCGAGAAGCTCATACAGGAACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144672.3-756s21c1
Sequence:CCGGGGGTCAGTGCGGAACACTTATCTCGAGATAAGTGTTCCGCACTGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144672.3-1286s21c1
Sequence:CCGGATCATCTTGTCTGCCAAATACCTCGAGGTATTTGGCAGACAAGATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144672
OTOA MISSION shRNA Lentiviral Transduction Particles
otoancorin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-61s1c1
Sequence:CCGGGTCGAGTTATACAGTGCCAAACTCGAGTTTGGCACTGTATAACTCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144672.3-150s21c1
Sequence:CCGGATGCACTGCTGGATCTCATACCTCGAGGTATGAGATCCAGCAGTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-1862s1c1
Sequence:CCGGGCGTGGAAATACTGGGAAGTTCTCGAGAACTTCCCAGTATTTCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-362s1c1
Sequence:CCGGGCCATGAAATGCCTCTTAGAACTCGAGTTCTAAGAGGCATTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-63s1c1
Sequence:CCGGCGAGTTATACAGTGCCAAATTCTCGAGAATTTGGCACTGTATAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144672.2-1673s1c1
Sequence:CCGGGCTCTGTTCCTGTATGAGCTTCTCGAGAAGCTCATACAGGAACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144672.3-756s21c1
Sequence:CCGGGGGTCAGTGCGGAACACTTATCTCGAGATAAGTGTTCCGCACTGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144672.3-1286s21c1
Sequence:CCGGATCATCTTGTCTGCCAAATACCTCGAGGTATTTGGCAGACAAGATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139310
OTOA MISSION shRNA Bacterial Glycerol Stock
otoancorin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139310.1-3501s1c1
Sequence:CCGGGCCTGTTGAGTGTTGCAAGAACTCGAGTTCTTGCAACACTCAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-2958s1c1
Sequence:CCGGCCCACTGAAATACAACTTATACTCGAGTATAAGTTGTATTTCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-196s1c1
Sequence:CCGGCGGAAGAAATAATAGAGGGAACTCGAGTTCCCTCTATTATTTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-717s1c1
Sequence:CCGGGCAGTGTTCAAAGACCTCTATCTCGAGATAGAGGTCTTTGAACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-492s1c1
Sequence:CCGGGTCATCAACTTGGGAGACATTCTCGAGAATGTCTCCCAAGTTGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139310
OTOA MISSION shRNA shRNA Plasmid DNA
otoancorin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139310.1-3501s1c1
Sequence:CCGGGCCTGTTGAGTGTTGCAAGAACTCGAGTTCTTGCAACACTCAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-2958s1c1
Sequence:CCGGCCCACTGAAATACAACTTATACTCGAGTATAAGTTGTATTTCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-196s1c1
Sequence:CCGGCGGAAGAAATAATAGAGGGAACTCGAGTTCCCTCTATTATTTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-717s1c1
Sequence:CCGGGCAGTGTTCAAAGACCTCTATCTCGAGATAGAGGTCTTTGAACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-492s1c1
Sequence:CCGGGTCATCAACTTGGGAGACATTCTCGAGAATGTCTCCCAAGTTGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139310
OTOA MISSION shRNA Lentiviral Transduction Particles
otoancorin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139310.1-3501s1c1
Sequence:CCGGGCCTGTTGAGTGTTGCAAGAACTCGAGTTCTTGCAACACTCAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-2958s1c1
Sequence:CCGGCCCACTGAAATACAACTTATACTCGAGTATAAGTTGTATTTCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-196s1c1
Sequence:CCGGCGGAAGAAATAATAGAGGGAACTCGAGTTCCCTCTATTATTTCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-717s1c1
Sequence:CCGGGCAGTGTTCAAAGACCTCTATCTCGAGATAGAGGTCTTTGAACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139310.1-492s1c1
Sequence:CCGGGTCATCAACTTGGGAGACATTCTCGAGAATGTCTCCCAAGTTGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)