EMAIL THIS PAGE TO A FRIEND

OTOF

otoferlin

102 Gene Product Result for
Synonyms: AUNB1 DFNB6 DFNB9 FER1L2 NSRD9
Gene ID:
Human(9381) Summary: Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(83762) otoferlin
Rat(84573) otoferlin
Zebrafish(557476) otoferlin
cow(617299) otoferlin
Horse(100071343) otoferlin
dog(607961) otoferlin
chicken(422007) otoferlin
sheep(101111175) otoferlin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194323 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146071 MISSION® esiRNA esiRNA human OTOF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004802 Rosetta Predictions human pricing
NM_194248 Rosetta Predictions human pricing
NM_194322 Rosetta Predictions human pricing
NM_194323 Rosetta Predictions human pricing
XM_001062291 Rosetta Predictions rat pricing
XM_001065408 Rosetta Predictions rat pricing
NM_001100395 Rosetta Predictions mouse pricing
NM_031875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208203 predicted 1270
2 SASI_Hs01_00208204 predicted 2535
3 SASI_Hs01_00208206 predicted 2131
4 SASI_Hs01_00208207 predicted 2130
5 SASI_Hs01_00208208 predicted 1034
6 SASI_Hs01_00208209 predicted 1042
7 SASI_Hs02_00338344 predicted 3432
8 SASI_Hs01_00208210 predicted 3334
9 SASI_Hs01_00208211 predicted 2729
10 SASI_Hs01_00208212 predicted 2600
11 SASI_Hs01_00208205 predicted 3142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078532 predicted 3407
2 SASI_Hs01_00078533 predicted 4733
3 SASI_Hs01_00078535 predicted 4333
4 SASI_Hs01_00078536 predicted 4333
5 SASI_Hs01_00078537 predicted 3170
6 SASI_Hs01_00078538 predicted 3188
7 SASI_Hs02_00371364 predicted 5630
8 SASI_Hs01_00078539 predicted 5529
9 SASI_Hs01_00078540 predicted 4928
10 SASI_Hs01_00078541 predicted 4804
11 SASI_Hs01_00078534 predicted 5347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214508 predicted 1359
2 SASI_Hs01_00214509 predicted 2692
3 SASI_Hs01_00214511 predicted 2282
4 SASI_Hs01_00214512 predicted 2283
5 SASI_Hs01_00214513 predicted 1125
6 SASI_Hs01_00214514 predicted 1138
7 SASI_Hs02_00371461 predicted 3587
8 SASI_Hs01_00214515 predicted 3480
9 SASI_Hs01_00214516 predicted 2883
10 SASI_Hs01_00214517 predicted 2748
11 SASI_Hs01_00214510 predicted 3302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172063 predicted 1270
2 SASI_Hs01_00172064 predicted 2535
3 SASI_Hs01_00172066 predicted 2125
4 SASI_Hs02_00371462 predicted 2127
5 SASI_Hs01_00172067 predicted 1027
6 SASI_Hs01_00172068 predicted 1045
7 SASI_Hs01_00172069 predicted 3431
8 SASI_Hs01_00172070 predicted 3327
9 SASI_Hs01_00172071 predicted 2726
10 SASI_Hs02_00371463 predicted 894
11 SASI_Hs01_00172065 predicted 3150
12 SASI_Hs01_00172072 predicted 2607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302966 predicted 639
2 SASI_Rn02_00302967 predicted 1995
3 SASI_Rn02_00302968 predicted 1099
4 SASI_Rn02_00302969 predicted 1562
5 SASI_Rn02_00302970 predicted 1717
6 SASI_Rn02_00302971 predicted 2049
7 SASI_Rn02_00302972 predicted 2037
8 SASI_Rn02_00302973 predicted 2066
9 SASI_Rn02_00302974 predicted 1067
10 SASI_Rn02_00302975 predicted 2365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314034 predicted 5870
2 SASI_Rn02_00314035 predicted 1090
3 SASI_Rn02_00314036 predicted 4307
4 SASI_Rn02_00314037 predicted 5785
5 SASI_Rn02_00314038 predicted 2036
6 SASI_Rn02_00314039 predicted 4887
7 SASI_Rn02_00314040 predicted 3467
8 SASI_Rn02_00314041 predicted 5801
9 SASI_Rn02_00314042 predicted 4298
10 SASI_Rn02_00314043 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302203 predicted 2546
2 SASI_Mm02_00302204 predicted 2708
3 SASI_Mm02_00302205 predicted 1027
4 SASI_Mm02_00302206 predicted 3486
5 SASI_Mm02_00302207 predicted 3147
6 SASI_Mm02_00302208 predicted 5646
7 SASI_Mm02_00302209 predicted 5519
8 SASI_Mm02_00302210 predicted 1059
9 SASI_Mm02_00302211 predicted 1259
10 SASI_Mm02_00302212 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031377 predicted 2502
2 SASI_Mm01_00031378 predicted 2665
3 SASI_Mm02_00337191 predicted 980
4 SASI_Mm02_00337192 predicted 3444
5 SASI_Mm01_00031381 predicted 3103
6 SASI_Mm01_00031382 predicted 5665
7 SASI_Mm02_00337193 predicted 5537
8 SASI_Mm01_00031383 predicted 1009
9 SASI_Mm01_00031385 predicted 1214
10 SASI_Mm02_00337194 predicted 194
11 SASI_Mm01_00031379 predicted 6184
12 SASI_Mm01_00031380 predicted 2312
13 SASI_Mm01_00031384 predicted 5957
14 SASI_Mm01_00031386 predicted 3724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194323
OTOF MISSION shRNA Bacterial Glycerol Stock
otoferlin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194323.2-4360s21c1
Sequence:CCGGTGCAGATAGCACCGGTCTTTGCTCGAGCAAAGACCGGTGCTATCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194323.2-4301s21c1
Sequence:CCGGGTCAGTGCCCAGGGCTTTAAACTCGAGTTTAAAGCCCTGGGCACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194323.1-4357s1c1
Sequence:CCGGCCCTGCAGATAGCACCGGTATCTCGAGATACCGGTGCTATCTGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-1070s1c1
Sequence:CCGGCCGCCCATCATTGTCATTGAACTCGAGTTCAATGACAATGATGGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-1491s1c1
Sequence:CCGGCGTCCCTGATCCACAATTATACTCGAGTATAATTGTGGATCAGGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-2540s1c1
Sequence:CCGGCCTGTCTTTGGGAAGTCCTTTCTCGAGAAAGGACTTCCCAAAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-3608s1c1
Sequence:CCGGCGCAATGAGAACGATGAGTTTCTCGAGAAACTCATCGTTCTCATTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194323
OTOF MISSION shRNA shRNA Plasmid DNA
otoferlin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194323.2-4360s21c1
Sequence:CCGGTGCAGATAGCACCGGTCTTTGCTCGAGCAAAGACCGGTGCTATCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194323.2-4301s21c1
Sequence:CCGGGTCAGTGCCCAGGGCTTTAAACTCGAGTTTAAAGCCCTGGGCACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194323.1-4357s1c1
Sequence:CCGGCCCTGCAGATAGCACCGGTATCTCGAGATACCGGTGCTATCTGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-1070s1c1
Sequence:CCGGCCGCCCATCATTGTCATTGAACTCGAGTTCAATGACAATGATGGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-1491s1c1
Sequence:CCGGCGTCCCTGATCCACAATTATACTCGAGTATAATTGTGGATCAGGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-2540s1c1
Sequence:CCGGCCTGTCTTTGGGAAGTCCTTTCTCGAGAAAGGACTTCCCAAAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-3608s1c1
Sequence:CCGGCGCAATGAGAACGATGAGTTTCTCGAGAAACTCATCGTTCTCATTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194323
OTOF MISSION shRNA Lentiviral Transduction Particles
otoferlin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194323.2-4360s21c1
Sequence:CCGGTGCAGATAGCACCGGTCTTTGCTCGAGCAAAGACCGGTGCTATCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194323.2-4301s21c1
Sequence:CCGGGTCAGTGCCCAGGGCTTTAAACTCGAGTTTAAAGCCCTGGGCACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194323.1-4357s1c1
Sequence:CCGGCCCTGCAGATAGCACCGGTATCTCGAGATACCGGTGCTATCTGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-1070s1c1
Sequence:CCGGCCGCCCATCATTGTCATTGAACTCGAGTTCAATGACAATGATGGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-1491s1c1
Sequence:CCGGCGTCCCTGATCCACAATTATACTCGAGTATAATTGTGGATCAGGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-2540s1c1
Sequence:CCGGCCTGTCTTTGGGAAGTCCTTTCTCGAGAAAGGACTTCCCAAAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194323.1-3608s1c1
Sequence:CCGGCGCAATGAGAACGATGAGTTTCTCGAGAAACTCATCGTTCTCATTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031875
OTOF MISSION shRNA Bacterial Glycerol Stock
otoferlin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031875.2-3187s21c1
Sequence:CCGGACGGTGAAGCTCACGAGTTACCTCGAGGTAACTCGTGAGCTTCACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031875.2-2252s21c1
Sequence:CCGGGCGCAAGCCCTGCATCTATATCTCGAGATATAGATGCAGGGCTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031875.1-6629s1c1
Sequence:CCGGCCAGTGAAATTAACCAAGAAACTCGAGTTTCTTGGTTAATTTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-5787s1c1
Sequence:CCGGCGCAATGAGAATGATGAGTTTCTCGAGAAACTCATCATTCTCATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-2573s1c1
Sequence:CCGGGCTGAGGTTATGCCAGAACTTCTCGAGAAGTTCTGGCATAACCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-3607s1c1
Sequence:CCGGCCTCCCTGATTCACAATTATACTCGAGTATAATTGTGAATCAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-1956s1c1
Sequence:CCGGGCCTCAATGATTGACCGGAAACTCGAGTTTCCGGTCAATCATTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031875
OTOF MISSION shRNA shRNA Plasmid DNA
otoferlin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031875.2-3187s21c1
Sequence:CCGGACGGTGAAGCTCACGAGTTACCTCGAGGTAACTCGTGAGCTTCACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031875.2-2252s21c1
Sequence:CCGGGCGCAAGCCCTGCATCTATATCTCGAGATATAGATGCAGGGCTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031875.1-6629s1c1
Sequence:CCGGCCAGTGAAATTAACCAAGAAACTCGAGTTTCTTGGTTAATTTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-5787s1c1
Sequence:CCGGCGCAATGAGAATGATGAGTTTCTCGAGAAACTCATCATTCTCATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-2573s1c1
Sequence:CCGGGCTGAGGTTATGCCAGAACTTCTCGAGAAGTTCTGGCATAACCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-3607s1c1
Sequence:CCGGCCTCCCTGATTCACAATTATACTCGAGTATAATTGTGAATCAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-1956s1c1
Sequence:CCGGGCCTCAATGATTGACCGGAAACTCGAGTTTCCGGTCAATCATTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031875
OTOF MISSION shRNA Lentiviral Transduction Particles
otoferlin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031875.2-3187s21c1
Sequence:CCGGACGGTGAAGCTCACGAGTTACCTCGAGGTAACTCGTGAGCTTCACCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031875.2-2252s21c1
Sequence:CCGGGCGCAAGCCCTGCATCTATATCTCGAGATATAGATGCAGGGCTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031875.1-6629s1c1
Sequence:CCGGCCAGTGAAATTAACCAAGAAACTCGAGTTTCTTGGTTAATTTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-5787s1c1
Sequence:CCGGCGCAATGAGAATGATGAGTTTCTCGAGAAACTCATCATTCTCATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-2573s1c1
Sequence:CCGGGCTGAGGTTATGCCAGAACTTCTCGAGAAGTTCTGGCATAACCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-3607s1c1
Sequence:CCGGCCTCCCTGATTCACAATTATACTCGAGTATAATTGTGAATCAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031875.1-1956s1c1
Sequence:CCGGGCCTCAATGATTGACCGGAAACTCGAGTTTCCGGTCAATCATTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)