EMAIL THIS PAGE TO A FRIEND

OTOGL

otogelin-like

95 Gene Product Result for
Synonyms: C12orf64 DFNB84B
UniProtKB ID: Q3ZCN5, F8W0C3, Q495U8, Q8N8G5, Q8NC28
Gene ID:
Human(283310) Summary: The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Mouse(628870) otogelin-like
Rat(685868) otogelin-like
Zebrafish(555569) otogelin-like
chicken(772154) otogelin-like
domestic cat(101090531) otogelin-like
Horse(100060599) otogelin-like
cow(531410) otogelin-like
dog(611522) otogelin-like
sheep(101103553) otogelin-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173591 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173591 Rosetta Predictions human pricing
XM_001065563 Rosetta Predictions rat pricing
XM_001478590 Rosetta Predictions mouse pricing
XM_893664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095158 predicted 1005
2 SASI_Hs01_00095159 predicted 1053
3 SASI_Hs01_00095160 predicted 1119
4 SASI_Hs01_00095161 predicted 1352
5 SASI_Hs01_00095162 predicted 1325
6 SASI_Hs01_00095163 predicted 636
7 SASI_Hs01_00095164 predicted 764
8 SASI_Hs01_00095165 predicted 554
9 SASI_Hs01_00095166 predicted 651
10 SASI_Hs01_00095167 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314624 predicted 2558
2 SASI_Rn02_00314625 predicted 763
3 SASI_Rn02_00314626 predicted 3268
4 SASI_Rn02_00314627 predicted 1273
5 SASI_Rn02_00314628 predicted 2543
6 SASI_Rn02_00314629 predicted 1989
7 SASI_Rn02_00314630 predicted 2516
8 SASI_Rn02_00314631 predicted 2040
9 SASI_Rn02_00314632 predicted 545
10 SASI_Rn02_00314633 predicted 2306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00403760 predicted 6259
2 SASI_Mm02_00403761 predicted 4714
3 SASI_Mm02_00403762 predicted 3378
4 SASI_Mm02_00403763 predicted 5887
5 SASI_Mm02_00403764 predicted 272
6 SASI_Mm02_00403765 predicted 3775
7 SASI_Mm02_00403766 predicted 5387
8 SASI_Mm02_00403767 predicted 774
9 SASI_Mm02_00403768 predicted 3824
10 SASI_Mm02_00403769 predicted 6297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00429370 predicted 6641
2 SASI_Mm02_00429371 predicted 5104
3 SASI_Mm01_00241479 predicted 3553
4 SASI_Mm02_00429372 predicted 6269
5 SASI_Mm02_00429373 predicted 4739
6 SASI_Mm02_00429374 predicted 3953
7 SASI_Mm02_00429375 predicted 5772
8 SASI_Mm01_00241485 predicted 1053
9 SASI_Mm02_00429376 predicted 4005
10 SASI_Mm02_00429377 predicted 6684
11 SASI_Mm01_00241477 predicted 1533
12 SASI_Mm01_00241478 predicted 2955
13 SASI_Mm01_00241480 predicted 2688
14 SASI_Mm01_00241481 predicted 937
15 SASI_Mm01_00241482 predicted 1772
16 SASI_Mm01_00241483 predicted 3365
17 SASI_Mm01_00241484 predicted 1444
18 SASI_Mm01_00241486 predicted 1437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173591
OTOGL MISSION shRNA Bacterial Glycerol Stock
otogelin-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173591.1-1114s1c1
Sequence:CCGGGCCCTATAAATGTTGCATCTTCTCGAGAAGATGCAACATTTATAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173591.1-1878s1c1
Sequence:CCGGGCTGTGTGACTCGTACAAATTCTCGAGAATTTGTACGAGTCACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173591.1-297s1c1
Sequence:CCGGCCTGTTCCACTATGTCATGATCTCGAGATCATGACATAGTGGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173591.1-2122s1c1
Sequence:CCGGGCAGGGAAATATAGCATCATTCTCGAGAATGATGCTATATTTCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173591.1-1548s1c1
Sequence:CCGGGCTGGAATGCTGTTATGTATTCTCGAGAATACATAACAGCATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173591
OTOGL MISSION shRNA shRNA Plasmid DNA
otogelin-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173591.1-1114s1c1
Sequence:CCGGGCCCTATAAATGTTGCATCTTCTCGAGAAGATGCAACATTTATAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173591.1-1878s1c1
Sequence:CCGGGCTGTGTGACTCGTACAAATTCTCGAGAATTTGTACGAGTCACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173591.1-297s1c1
Sequence:CCGGCCTGTTCCACTATGTCATGATCTCGAGATCATGACATAGTGGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173591.1-2122s1c1
Sequence:CCGGGCAGGGAAATATAGCATCATTCTCGAGAATGATGCTATATTTCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173591.1-1548s1c1
Sequence:CCGGGCTGGAATGCTGTTATGTATTCTCGAGAATACATAACAGCATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173591
OTOGL MISSION shRNA Lentiviral Transduction Particles
otogelin-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173591.1-1114s1c1
Sequence:CCGGGCCCTATAAATGTTGCATCTTCTCGAGAAGATGCAACATTTATAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173591.1-1878s1c1
Sequence:CCGGGCTGTGTGACTCGTACAAATTCTCGAGAATTTGTACGAGTCACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173591.1-297s1c1
Sequence:CCGGCCTGTTCCACTATGTCATGATCTCGAGATCATGACATAGTGGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173591.1-2122s1c1
Sequence:CCGGGCAGGGAAATATAGCATCATTCTCGAGAATGATGCTATATTTCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173591.1-1548s1c1
Sequence:CCGGGCTGGAATGCTGTTATGTATTCTCGAGAATACATAACAGCATTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)