EMAIL THIS PAGE TO A FRIEND

OTOP2

otopetrin 2

61 Gene Product Result for
UniProtKB ID: Q7RTS6
Gene ID:
Mouse(237987) otopetrin 2
Rat(287820) otopetrin 2
sheep(101102159) otopetrin 2
Zebrafish(494472) otopetrin 2
chicken(422111) otopetrin 2
cow(527835) otopetrin 2
dog(483303) otopetrin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178160 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141011 MISSION® esiRNA esiRNA human OTOP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178160 Rosetta Predictions human pricing
NM_001105851 Rosetta Predictions rat pricing
NM_172801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149645 predicted 923
2 SASI_Hs01_00149646 predicted 602
3 SASI_Hs01_00149647 predicted 1492
4 SASI_Hs01_00149648 predicted 588
5 SASI_Hs01_00149650 predicted 1059
6 SASI_Hs01_00149651 predicted 1077
7 SASI_Hs02_00369567 predicted 568
8 SASI_Hs02_00369568 predicted 1123
9 SASI_Hs01_00149652 predicted 447
10 SASI_Hs01_00149653 predicted 863
11 SASI_Hs01_00149644 predicted 668
12 SASI_Hs01_00149649 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213152 predicted 1076
2 SASI_Rn02_00213153 predicted 519
3 SASI_Rn02_00213154 predicted 561
4 SASI_Rn02_00213155 predicted 815
5 SASI_Rn02_00213156 predicted 1069
6 SASI_Rn02_00213157 predicted 802
7 SASI_Rn02_00213158 predicted 1071
8 SASI_Rn02_00213159 predicted 456
9 SASI_Rn02_00213160 predicted 252
10 SASI_Rn02_00213161 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130202 predicted 1928
2 SASI_Mm01_00130203 predicted 1022
3 SASI_Mm01_00130204 predicted 1467
4 SASI_Mm01_00130205 predicted 1307
5 SASI_Mm01_00130206 predicted 752
6 SASI_Mm01_00130207 predicted 1548
7 SASI_Mm01_00130208 predicted 691
8 SASI_Mm01_00130209 predicted 1313
9 SASI_Mm01_00130210 predicted 758
10 SASI_Mm01_00130211 predicted 1800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178160
OTOP2 MISSION shRNA Bacterial Glycerol Stock
otopetrin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178160.1-453s21c1
Sequence:CCGGACCGGCTACTACTCCAGTTTCCTCGAGGAAACTGGAGTAGTAGCCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1597s1c1
Sequence:CCGGGCAATGTCATTCTGTGGATCACTCGAGTGATCCACAGAATGACATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1581s1c1
Sequence:CCGGCTGTTTCTCCTACTCTGCAATCTCGAGATTGCAGAGTAGGAGAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178160.1-818s21c1
Sequence:CCGGATATCCCTTCAACATCGAGTACTCGAGTACTCGATGTTGAAGGGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1334s1c1
Sequence:CCGGCTTCCAGAACATGTTTATCATCTCGAGATGATAAACATGTTCTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1595s1c1
Sequence:CCGGCTGCAATGTCATTCTGTGGATCTCGAGATCCACAGAATGACATTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-524s1c1
Sequence:CCGGGTTTGTCATCATCCAGACCTACTCGAGTAGGTCTGGATGATGACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178160.1-657s21c1
Sequence:CCGGGATGAATCTGTGCACCAATCCCTCGAGGGATTGGTGCACAGATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178160
OTOP2 MISSION shRNA shRNA Plasmid DNA
otopetrin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178160.1-453s21c1
Sequence:CCGGACCGGCTACTACTCCAGTTTCCTCGAGGAAACTGGAGTAGTAGCCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1597s1c1
Sequence:CCGGGCAATGTCATTCTGTGGATCACTCGAGTGATCCACAGAATGACATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1581s1c1
Sequence:CCGGCTGTTTCTCCTACTCTGCAATCTCGAGATTGCAGAGTAGGAGAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178160.1-818s21c1
Sequence:CCGGATATCCCTTCAACATCGAGTACTCGAGTACTCGATGTTGAAGGGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1334s1c1
Sequence:CCGGCTTCCAGAACATGTTTATCATCTCGAGATGATAAACATGTTCTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1595s1c1
Sequence:CCGGCTGCAATGTCATTCTGTGGATCTCGAGATCCACAGAATGACATTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-524s1c1
Sequence:CCGGGTTTGTCATCATCCAGACCTACTCGAGTAGGTCTGGATGATGACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178160.1-657s21c1
Sequence:CCGGGATGAATCTGTGCACCAATCCCTCGAGGGATTGGTGCACAGATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178160
OTOP2 MISSION shRNA Lentiviral Transduction Particles
otopetrin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178160.1-453s21c1
Sequence:CCGGACCGGCTACTACTCCAGTTTCCTCGAGGAAACTGGAGTAGTAGCCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1597s1c1
Sequence:CCGGGCAATGTCATTCTGTGGATCACTCGAGTGATCCACAGAATGACATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1581s1c1
Sequence:CCGGCTGTTTCTCCTACTCTGCAATCTCGAGATTGCAGAGTAGGAGAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178160.1-818s21c1
Sequence:CCGGATATCCCTTCAACATCGAGTACTCGAGTACTCGATGTTGAAGGGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1334s1c1
Sequence:CCGGCTTCCAGAACATGTTTATCATCTCGAGATGATAAACATGTTCTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-1595s1c1
Sequence:CCGGCTGCAATGTCATTCTGTGGATCTCGAGATCCACAGAATGACATTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178160.1-524s1c1
Sequence:CCGGGTTTGTCATCATCCAGACCTACTCGAGTAGGTCTGGATGATGACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178160.1-657s21c1
Sequence:CCGGGATGAATCTGTGCACCAATCCCTCGAGGGATTGGTGCACAGATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172801
OTOP2 MISSION shRNA Bacterial Glycerol Stock
otopetrin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1463s1c1
Sequence:CCGGCCAATACGCTATCTCCTACTACTCGAGTAGTAGGAGATAGCGTATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-773s1c1
Sequence:CCGGCCAGACTTACTTTCTCTGGATCTCGAGATCCAGAGAAAGTAAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1100s1c1
Sequence:CCGGGCTGTATGTCATGTGGAAGAACTCGAGTTCTTCCACATGACATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1085s1c1
Sequence:CCGGCTTTGCTTCCACCATGCTGTACTCGAGTACAGCATGGTGGAAGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1658s1c1
Sequence:CCGGCCAAGGCATCACCTTTGCTAACTCGAGTTAGCAAAGGTGATGCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172801
OTOP2 MISSION shRNA shRNA Plasmid DNA
otopetrin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1463s1c1
Sequence:CCGGCCAATACGCTATCTCCTACTACTCGAGTAGTAGGAGATAGCGTATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-773s1c1
Sequence:CCGGCCAGACTTACTTTCTCTGGATCTCGAGATCCAGAGAAAGTAAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1100s1c1
Sequence:CCGGGCTGTATGTCATGTGGAAGAACTCGAGTTCTTCCACATGACATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1085s1c1
Sequence:CCGGCTTTGCTTCCACCATGCTGTACTCGAGTACAGCATGGTGGAAGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1658s1c1
Sequence:CCGGCCAAGGCATCACCTTTGCTAACTCGAGTTAGCAAAGGTGATGCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172801
OTOP2 MISSION shRNA Lentiviral Transduction Particles
otopetrin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1463s1c1
Sequence:CCGGCCAATACGCTATCTCCTACTACTCGAGTAGTAGGAGATAGCGTATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-773s1c1
Sequence:CCGGCCAGACTTACTTTCTCTGGATCTCGAGATCCAGAGAAAGTAAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1100s1c1
Sequence:CCGGGCTGTATGTCATGTGGAAGAACTCGAGTTCTTCCACATGACATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1085s1c1
Sequence:CCGGCTTTGCTTCCACCATGCTGTACTCGAGTACAGCATGGTGGAAGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172801.1-1658s1c1
Sequence:CCGGCCAAGGCATCACCTTTGCTAACTCGAGTTAGCAAAGGTGATGCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)