EMAIL THIS PAGE TO A FRIEND

OTOP3

otopetrin 3

46 Gene Product Result for
UniProtKB ID: Q7RTS5
Gene ID:
Mouse(69602) otopetrin 3
Rat(287821) otopetrin 3
chicken(422112) otopetrin 3
cow(100337117) otopetrin 3
Horse(100060249) otopetrin 3
dog(483304) otopetrin 3
sheep(101101904) otopetrin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178233 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153421 MISSION® esiRNA esiRNA human OTOP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178233 Rosetta Predictions human pricing
NM_001105852 Rosetta Predictions rat pricing
NM_027132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048350 predicted 240
2 SASI_Hs01_00048351 predicted 280
3 SASI_Hs01_00048352 predicted 1088
4 SASI_Hs01_00048353 predicted 797
5 SASI_Hs01_00048355 predicted 515
6 SASI_Hs02_00369609 predicted 302
7 SASI_Hs01_00048356 predicted 651
8 SASI_Hs01_00048357 predicted 428
9 SASI_Hs01_00048358 predicted 588
10 SASI_Hs01_00048359 predicted 1377
11 SASI_Hs01_00048354 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213162 predicted 1887
2 SASI_Rn02_00213163 predicted 1403
3 SASI_Rn02_00213164 predicted 620
4 SASI_Rn02_00213165 predicted 1111
5 SASI_Rn02_00213166 predicted 416
6 SASI_Rn02_00213167 predicted 1837
7 SASI_Rn02_00213168 predicted 1224
8 SASI_Rn02_00213169 predicted 1130
9 SASI_Rn02_00213170 predicted 1870
10 SASI_Rn02_00213171 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110717 predicted 690
2 SASI_Mm01_00110718 predicted 370
3 SASI_Mm01_00110719 predicted 1353
4 SASI_Mm01_00110720 predicted 1528
5 SASI_Mm01_00110722 predicted 1512
6 SASI_Mm01_00110723 predicted 409
7 SASI_Mm01_00110724 predicted 632
8 SASI_Mm02_00331621 predicted 1804
9 SASI_Mm01_00110725 predicted 674
10 SASI_Mm01_00110726 predicted 1257
11 SASI_Mm01_00110721 predicted 1202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027132
OTOP3 MISSION shRNA Bacterial Glycerol Stock
otopetrin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-1268s21c1
Sequence:CCGGCCCTCTACTATGCGTTCTATGCTCGAGCATAGAACGCATAGTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-610s21c1
Sequence:CCGGACCGTCTGCCTGAACATATTTCTCGAGAAATATGTTCAGGCAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-689s21c1
Sequence:CCGGCGGCCATTGAGATTGTCTTTACTCGAGTAAAGACAATCTCAATGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-1845s21c1
Sequence:CCGGGACCTGGTTCACCATTGTTAACTCGAGTTAACAATGGTGAACCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027132.2-2188s21c1
Sequence:CCGGCTGTGAGGGTCAGTATGAAATCTCGAGATTTCATACTGACCCTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027132
OTOP3 MISSION shRNA shRNA Plasmid DNA
otopetrin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-1268s21c1
Sequence:CCGGCCCTCTACTATGCGTTCTATGCTCGAGCATAGAACGCATAGTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-610s21c1
Sequence:CCGGACCGTCTGCCTGAACATATTTCTCGAGAAATATGTTCAGGCAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-689s21c1
Sequence:CCGGCGGCCATTGAGATTGTCTTTACTCGAGTAAAGACAATCTCAATGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-1845s21c1
Sequence:CCGGGACCTGGTTCACCATTGTTAACTCGAGTTAACAATGGTGAACCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027132.2-2188s21c1
Sequence:CCGGCTGTGAGGGTCAGTATGAAATCTCGAGATTTCATACTGACCCTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027132
OTOP3 MISSION shRNA Lentiviral Transduction Particles
otopetrin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-1268s21c1
Sequence:CCGGCCCTCTACTATGCGTTCTATGCTCGAGCATAGAACGCATAGTAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-610s21c1
Sequence:CCGGACCGTCTGCCTGAACATATTTCTCGAGAAATATGTTCAGGCAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-689s21c1
Sequence:CCGGCGGCCATTGAGATTGTCTTTACTCGAGTAAAGACAATCTCAATGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027132.2-1845s21c1
Sequence:CCGGGACCTGGTTCACCATTGTTAACTCGAGTTAACAATGGTGAACCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027132.2-2188s21c1
Sequence:CCGGCTGTGAGGGTCAGTATGAAATCTCGAGATTTCATACTGACCCTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178233
OTOP3 MISSION shRNA Bacterial Glycerol Stock
otopetrin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178233.1-1119s1c1
Sequence:CCGGCCTCTACTATGCCTTCTATGTCTCGAGACATAGAAGGCATAGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-1058s1c1
Sequence:CCGGGCGTCTTTGTGCTCTTCCAAACTCGAGTTTGGAAGAGCACAAAGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-921s1c1
Sequence:CCGGGCTGTTTGTCATGTGGAAGAACTCGAGTTCTTCCACATGACAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-1611s1c1
Sequence:CCGGCAATATCACACTGTGGATGATCTCGAGATCATCCACAGTGTGATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-1107s1c1
Sequence:CCGGCCAGTACTTCACCCTCTACTACTCGAGTAGTAGAGGGTGAAGTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178233
OTOP3 MISSION shRNA shRNA Plasmid DNA
otopetrin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178233.1-1119s1c1
Sequence:CCGGCCTCTACTATGCCTTCTATGTCTCGAGACATAGAAGGCATAGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-1058s1c1
Sequence:CCGGGCGTCTTTGTGCTCTTCCAAACTCGAGTTTGGAAGAGCACAAAGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-921s1c1
Sequence:CCGGGCTGTTTGTCATGTGGAAGAACTCGAGTTCTTCCACATGACAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-1611s1c1
Sequence:CCGGCAATATCACACTGTGGATGATCTCGAGATCATCCACAGTGTGATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-1107s1c1
Sequence:CCGGCCAGTACTTCACCCTCTACTACTCGAGTAGTAGAGGGTGAAGTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178233
OTOP3 MISSION shRNA Lentiviral Transduction Particles
otopetrin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178233.1-1119s1c1
Sequence:CCGGCCTCTACTATGCCTTCTATGTCTCGAGACATAGAAGGCATAGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-1058s1c1
Sequence:CCGGGCGTCTTTGTGCTCTTCCAAACTCGAGTTTGGAAGAGCACAAAGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-921s1c1
Sequence:CCGGGCTGTTTGTCATGTGGAAGAACTCGAGTTCTTCCACATGACAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-1611s1c1
Sequence:CCGGCAATATCACACTGTGGATGATCTCGAGATCATCCACAGTGTGATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178233.1-1107s1c1
Sequence:CCGGCCAGTACTTCACCCTCTACTACTCGAGTAGTAGAGGGTGAAGTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)