EMAIL THIS PAGE TO A FRIEND

OTOS

otospiralin

43 Gene Product Result for
Synonyms: OTOSP
UniProtKB ID: Q8NHW6, Q53SW6
Gene ID:
Human(150677) Summary: Otospiralin is synthesized by nonsensory cells (fibrocytes) of the inner ear, and downregulation of otospiralin in guinea pigs leads to deafness (Lavigne-Rebillard et al., 2003 [PubMed 12687421]
Mouse(260301) otospiralin
Rat(246044) otospiralin
cow(617392) otospiralin
dog(477428) otospiralin
sheep(101122143) otospiralin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148961 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148961 Rosetta Predictions human pricing
NM_139188 Rosetta Predictions rat pricing
NM_153114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198499 predicted 257
2 SASI_Hs01_00198500 predicted 340
3 SASI_Hs01_00198502 predicted 340
4 SASI_Hs01_00198503 predicted 279
5 SASI_Hs01_00198504 predicted 297
6 SASI_Hs01_00198506 predicted 256
7 SASI_Hs01_00198507 predicted 343
8 SASI_Hs01_00198508 predicted 268
9 SASI_Hs02_00365675 predicted 253
10 SASI_Hs02_00365676 predicted 279
11 SASI_Hs01_00198501 predicted 278
12 SASI_Hs01_00198505 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118324 predicted 220
2 SASI_Rn01_00118325 predicted 216
3 SASI_Rn01_00118326 predicted 249
4 SASI_Rn01_00118328 predicted 218
5 SASI_Rn01_00118329 predicted 229
6 SASI_Rn01_00118331 predicted 244
7 SASI_Rn01_00118332 predicted 219
8 SASI_Rn01_00118333 predicted 212
9 SASI_Rn01_00118327 predicted 223
10 SASI_Rn01_00118330 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126749 predicted 401
2 SASI_Mm01_00126750 predicted 317
3 SASI_Mm01_00126751 predicted 374
4 SASI_Mm01_00126752 predicted 379
5 SASI_Mm01_00126753 predicted 377
6 SASI_Mm01_00126755 predicted 330
7 SASI_Mm01_00126756 predicted 374
8 SASI_Mm01_00126757 predicted 384
9 SASI_Mm01_00126754 predicted 425
10 SASI_Mm01_00126758 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148961
OTOS MISSION shRNA Bacterial Glycerol Stock
otospiralin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148961.3-301s21c1
Sequence:CCGGACTATGTGCAGCACTTCCAGGCTCGAGCCTGGAAGTGCTGCACATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-349s1c1
Sequence:CCGGACATGGCCCGAACCTTCTTTGCTCGAGCAAAGAAGGTTCGGGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-394s1c1
Sequence:CCGGTGGGCTTCCACGTTCCCTATCCTCGAGGATAGGGAACGTGGAAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148961.3-227s21c1
Sequence:CCGGGCAGGAGGAAGGAGACCCTTACTCGAGTAAGGGTCTCCTTCCTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148961.3-403s21c1
Sequence:CCGGACGTTCCCTATCAGGAGGACTCTCGAGAGTCCTCCTGATAGGGAACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-286s1c1
Sequence:CCGGCCTCTGACTTCTGGAACTATGCTCGAGCATAGTTCCAGAAGTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-293s1c1
Sequence:CCGGCTTCTGGAACTATGTGCAGCACTCGAGTGCTGCACATAGTTCCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-277s1c1
Sequence:CCGGCTTTCTCCACCTCTGACTTCTCTCGAGAGAAGTCAGAGGTGGAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148961
OTOS MISSION shRNA shRNA Plasmid DNA
otospiralin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148961.3-301s21c1
Sequence:CCGGACTATGTGCAGCACTTCCAGGCTCGAGCCTGGAAGTGCTGCACATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-349s1c1
Sequence:CCGGACATGGCCCGAACCTTCTTTGCTCGAGCAAAGAAGGTTCGGGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-394s1c1
Sequence:CCGGTGGGCTTCCACGTTCCCTATCCTCGAGGATAGGGAACGTGGAAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148961.3-227s21c1
Sequence:CCGGGCAGGAGGAAGGAGACCCTTACTCGAGTAAGGGTCTCCTTCCTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148961.3-403s21c1
Sequence:CCGGACGTTCCCTATCAGGAGGACTCTCGAGAGTCCTCCTGATAGGGAACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-286s1c1
Sequence:CCGGCCTCTGACTTCTGGAACTATGCTCGAGCATAGTTCCAGAAGTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-293s1c1
Sequence:CCGGCTTCTGGAACTATGTGCAGCACTCGAGTGCTGCACATAGTTCCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-277s1c1
Sequence:CCGGCTTTCTCCACCTCTGACTTCTCTCGAGAGAAGTCAGAGGTGGAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148961
OTOS MISSION shRNA Lentiviral Transduction Particles
otospiralin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148961.3-301s21c1
Sequence:CCGGACTATGTGCAGCACTTCCAGGCTCGAGCCTGGAAGTGCTGCACATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-349s1c1
Sequence:CCGGACATGGCCCGAACCTTCTTTGCTCGAGCAAAGAAGGTTCGGGCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-394s1c1
Sequence:CCGGTGGGCTTCCACGTTCCCTATCCTCGAGGATAGGGAACGTGGAAGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148961.3-227s21c1
Sequence:CCGGGCAGGAGGAAGGAGACCCTTACTCGAGTAAGGGTCTCCTTCCTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148961.3-403s21c1
Sequence:CCGGACGTTCCCTATCAGGAGGACTCTCGAGAGTCCTCCTGATAGGGAACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-286s1c1
Sequence:CCGGCCTCTGACTTCTGGAACTATGCTCGAGCATAGTTCCAGAAGTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-293s1c1
Sequence:CCGGCTTCTGGAACTATGTGCAGCACTCGAGTGCTGCACATAGTTCCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148961.3-277s1c1
Sequence:CCGGCTTTCTCCACCTCTGACTTCTCTCGAGAGAAGTCAGAGGTGGAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153114
OTOS MISSION shRNA Bacterial Glycerol Stock
otospiralin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-551s21c1
Sequence:CCGGAGCACCCTAGGCTTCCATGTTCTCGAGAACATGGAAGCCTAGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-457s21c1
Sequence:CCGGCTTCTGGAACTACGTGCAATACTCGAGTATTGCACGTAGTTCCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-427s21c1
Sequence:CCGGTATGCCCTACTGGCCTTTCTCCTCGAGGAGAAAGGCCAGTAGGGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.2-584s1c1
Sequence:CCGGGATTGAGCAGTGTCTAGTCTTCTCGAGAAGACTAGACACTGCTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.2-457s1c1
Sequence:CCGGCTTCTGGAACTACGTGCAATACTCGAGTATTGCACGTAGTTCCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-496s21c1
Sequence:CCGGCTACCCACAGATCGAGGACATCTCGAGATGTCCTCGATCTGTGGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-584s21c1
Sequence:CCGGGATTGAGCAGTGTCTAGTCTTCTCGAGAAGACTAGACACTGCTCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.1-268s1c1
Sequence:CCGGCAGAACCTTCTTTGCACACTTCTCGAGAAGTGTGCAAAGAAGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.1-260s1c1
Sequence:CCGGGACATGGCCAGAACCTTCTTTCTCGAGAAAGAAGGTTCTGGCCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153114
OTOS MISSION shRNA shRNA Plasmid DNA
otospiralin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-551s21c1
Sequence:CCGGAGCACCCTAGGCTTCCATGTTCTCGAGAACATGGAAGCCTAGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-457s21c1
Sequence:CCGGCTTCTGGAACTACGTGCAATACTCGAGTATTGCACGTAGTTCCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-427s21c1
Sequence:CCGGTATGCCCTACTGGCCTTTCTCCTCGAGGAGAAAGGCCAGTAGGGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.2-584s1c1
Sequence:CCGGGATTGAGCAGTGTCTAGTCTTCTCGAGAAGACTAGACACTGCTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.2-457s1c1
Sequence:CCGGCTTCTGGAACTACGTGCAATACTCGAGTATTGCACGTAGTTCCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-496s21c1
Sequence:CCGGCTACCCACAGATCGAGGACATCTCGAGATGTCCTCGATCTGTGGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-584s21c1
Sequence:CCGGGATTGAGCAGTGTCTAGTCTTCTCGAGAAGACTAGACACTGCTCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.1-268s1c1
Sequence:CCGGCAGAACCTTCTTTGCACACTTCTCGAGAAGTGTGCAAAGAAGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.1-260s1c1
Sequence:CCGGGACATGGCCAGAACCTTCTTTCTCGAGAAAGAAGGTTCTGGCCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153114
OTOS MISSION shRNA Lentiviral Transduction Particles
otospiralin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-551s21c1
Sequence:CCGGAGCACCCTAGGCTTCCATGTTCTCGAGAACATGGAAGCCTAGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-457s21c1
Sequence:CCGGCTTCTGGAACTACGTGCAATACTCGAGTATTGCACGTAGTTCCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-427s21c1
Sequence:CCGGTATGCCCTACTGGCCTTTCTCCTCGAGGAGAAAGGCCAGTAGGGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.2-584s1c1
Sequence:CCGGGATTGAGCAGTGTCTAGTCTTCTCGAGAAGACTAGACACTGCTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.2-457s1c1
Sequence:CCGGCTTCTGGAACTACGTGCAATACTCGAGTATTGCACGTAGTTCCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-496s21c1
Sequence:CCGGCTACCCACAGATCGAGGACATCTCGAGATGTCCTCGATCTGTGGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153114.2-584s21c1
Sequence:CCGGGATTGAGCAGTGTCTAGTCTTCTCGAGAAGACTAGACACTGCTCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.1-268s1c1
Sequence:CCGGCAGAACCTTCTTTGCACACTTCTCGAGAAGTGTGCAAAGAAGGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153114.1-260s1c1
Sequence:CCGGGACATGGCCAGAACCTTCTTTCTCGAGAAAGAAGGTTCTGGCCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)