EMAIL THIS PAGE TO A FRIEND

OTP

orthopedia homeobox

124 Gene Product Result for
UniProtKB ID: Q5XKR4
Gene ID:
Human(23440) Summary: This gene encodes a member of the homeodomain (HD) family. HD family proteins are helix-turn-helix transcription factors that play key roles in the specification of cell fates. This protein may function during brain development. [provided by RefSeq, Jul 2008]
Mouse(18420) orthopedia homolog (Drosophila)
Rat(294640) orthopedia homeobox
sheep(101107527) orthopedia homeobox
domestic guinea pig(100717802) orthopedia homeobox
naked mole-rat(101714983) orthopedia homeobox
fruit fly(37364) orthopedia
cow(100125232) orthopedia homeobox
domestic cat(101080357) orthopedia homeobox
dog(488938) orthopedia homeobox
chicken(554220) orthopedia homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032109 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032109 Rosetta Predictions human pricing
XM_001059871 Rosetta Predictions rat pricing
XM_001059943 Rosetta Predictions rat pricing
XM_215445 Rosetta Predictions rat pricing
NM_011021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093909 predicted 608
2 SASI_Hs01_00093910 predicted 328
3 SASI_Hs01_00093911 predicted 2585
4 SASI_Hs01_00093912 predicted 1845
5 SASI_Hs01_00093913 predicted 2510
6 SASI_Hs01_00093914 predicted 2375
7 SASI_Hs01_00093915 predicted 2043
8 SASI_Hs01_00093916 predicted 2567
9 SASI_Hs01_00093917 predicted 2098
10 SASI_Hs01_00093918 predicted 1837
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294654 predicted 485
2 SASI_Rn02_00294655 predicted 303
3 SASI_Rn02_00294656 predicted 348
4 SASI_Rn02_00294657 predicted 361
5 SASI_Rn02_00294658 predicted 218
6 SASI_Rn02_00294659 predicted 329
7 SASI_Rn02_00294660 predicted 223
8 SASI_Rn02_00294661 predicted 286
9 SASI_Rn02_00294662 predicted 200
10 SASI_Rn02_00294663 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294887 predicted 475
2 SASI_Rn02_00294888 predicted 289
3 SASI_Rn02_00294889 predicted 368
4 SASI_Rn02_00294890 predicted 336
5 SASI_Rn02_00294891 predicted 349
6 SASI_Rn02_00294892 predicted 315
7 SASI_Rn02_00294893 predicted 289
8 SASI_Rn02_00294894 predicted 328
9 SASI_Rn02_00294895 predicted 430
10 SASI_Rn02_00294896 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375995 predicted 472
2 SASI_Rn02_00375996 predicted 283
3 SASI_Rn02_00375997 predicted 368
4 SASI_Rn02_00375998 predicted 339
5 SASI_Rn02_00375999 predicted 348
6 SASI_Rn02_00376000 predicted 315
7 SASI_Rn02_00376001 predicted 283
8 SASI_Rn02_00376002 predicted 329
9 SASI_Rn02_00376003 predicted 437
10 SASI_Rn02_00376004 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134050 predicted 500
2 SASI_Mm01_00134051 predicted 504
3 SASI_Mm01_00134052 predicted 608
4 SASI_Mm01_00134053 predicted 303
5 SASI_Mm01_00134054 predicted 471
6 SASI_Mm01_00134055 predicted 429
7 SASI_Mm01_00134056 predicted 481
8 SASI_Mm01_00134058 predicted 880
9 SASI_Mm01_00134059 predicted 741
10 SASI_Mm02_00319748 predicted 539
11 SASI_Mm01_00134057 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032109
OTP MISSION shRNA Bacterial Glycerol Stock
orthopedia homeobox
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032109.2-1110s21c1
Sequence:CCGGCTATGAGCTTCACTTAATGCACTCGAGTGCATTAAGTGAAGCTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-1099s1c1
Sequence:CCGGGCACACAGTCTCTATGAGCTTCTCGAGAAGCTCATAGAGACTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-1093s1c1
Sequence:CCGGGCTAGAGCACACAGTCTCTATCTCGAGATAGAGACTGTGTGCTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-535s1c1
Sequence:CCGGCGACATCTTTATGCGTGAGGACTCGAGTCCTCACGCATAAAGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032109.2-1849s1c1
Sequence:CCGGCCCAACTGATATGATTTGATTCTCGAGAATCAAATCATATCAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-742s1c1
Sequence:CCGGCCTGTGCTCTTTCCACGCCAACTCGAGTTGGCGTGGAAAGAGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032109.2-496s21c1
Sequence:CCGGCAACGAGTTGGAGAGGAGCTTCTCGAGAAGCTCCTCTCCAACTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032109
OTP MISSION shRNA shRNA Plasmid DNA
orthopedia homeobox
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032109.2-1110s21c1
Sequence:CCGGCTATGAGCTTCACTTAATGCACTCGAGTGCATTAAGTGAAGCTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-1099s1c1
Sequence:CCGGGCACACAGTCTCTATGAGCTTCTCGAGAAGCTCATAGAGACTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-1093s1c1
Sequence:CCGGGCTAGAGCACACAGTCTCTATCTCGAGATAGAGACTGTGTGCTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-535s1c1
Sequence:CCGGCGACATCTTTATGCGTGAGGACTCGAGTCCTCACGCATAAAGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032109.2-1849s1c1
Sequence:CCGGCCCAACTGATATGATTTGATTCTCGAGAATCAAATCATATCAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-742s1c1
Sequence:CCGGCCTGTGCTCTTTCCACGCCAACTCGAGTTGGCGTGGAAAGAGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032109.2-496s21c1
Sequence:CCGGCAACGAGTTGGAGAGGAGCTTCTCGAGAAGCTCCTCTCCAACTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032109
OTP MISSION shRNA Lentiviral Transduction Particles
orthopedia homeobox
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032109.2-1110s21c1
Sequence:CCGGCTATGAGCTTCACTTAATGCACTCGAGTGCATTAAGTGAAGCTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-1099s1c1
Sequence:CCGGGCACACAGTCTCTATGAGCTTCTCGAGAAGCTCATAGAGACTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-1093s1c1
Sequence:CCGGGCTAGAGCACACAGTCTCTATCTCGAGATAGAGACTGTGTGCTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-535s1c1
Sequence:CCGGCGACATCTTTATGCGTGAGGACTCGAGTCCTCACGCATAAAGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032109.2-1849s1c1
Sequence:CCGGCCCAACTGATATGATTTGATTCTCGAGAATCAAATCATATCAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032109.2-742s1c1
Sequence:CCGGCCTGTGCTCTTTCCACGCCAACTCGAGTTGGCGTGGAAAGAGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032109.2-496s21c1
Sequence:CCGGCAACGAGTTGGAGAGGAGCTTCTCGAGAAGCTCCTCTCCAACTCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011021
OTP MISSION shRNA Bacterial Glycerol Stock
orthopedia homeobox
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011021.3-614s21c1
Sequence:CCGGCAAGTGGAAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTTCCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-628s1c1
Sequence:CCGGGCGCAAGAAGACCACCAACGTCTCGAGACGTTGGTGGTCTTCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-173s1c1
Sequence:CCGGGCCAGGCTAGGTATGAAAGATCTCGAGATCTTTCATACCTAGCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-284s1c1
Sequence:CCGGCCCAACTCGGACCCGGTCGAACTCGAGTTCGACCGGGTCCGAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-738s1c1
Sequence:CCGGGCCTGTGCTCTTTCCACGCCACTCGAGTGGCGTGGAAAGAGCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-493s1c1
Sequence:CCGGCAACGAATTGGAGAGGAGCTTCTCGAGAAGCTCCTCTCCAATTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011021.3-444s21c1
Sequence:CCGGCAACAGAAACAGAAGCGCCACCTCGAGGTGGCGCTTCTGTTTCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011021.3-886s21c1
Sequence:CCGGACTCCATGGGCTTGTCCAACACTCGAGTGTTGGACAAGCCCATGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011021
OTP MISSION shRNA shRNA Plasmid DNA
orthopedia homeobox
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011021.3-614s21c1
Sequence:CCGGCAAGTGGAAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTTCCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-628s1c1
Sequence:CCGGGCGCAAGAAGACCACCAACGTCTCGAGACGTTGGTGGTCTTCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-173s1c1
Sequence:CCGGGCCAGGCTAGGTATGAAAGATCTCGAGATCTTTCATACCTAGCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-284s1c1
Sequence:CCGGCCCAACTCGGACCCGGTCGAACTCGAGTTCGACCGGGTCCGAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-738s1c1
Sequence:CCGGGCCTGTGCTCTTTCCACGCCACTCGAGTGGCGTGGAAAGAGCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-493s1c1
Sequence:CCGGCAACGAATTGGAGAGGAGCTTCTCGAGAAGCTCCTCTCCAATTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011021.3-444s21c1
Sequence:CCGGCAACAGAAACAGAAGCGCCACCTCGAGGTGGCGCTTCTGTTTCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011021.3-886s21c1
Sequence:CCGGACTCCATGGGCTTGTCCAACACTCGAGTGTTGGACAAGCCCATGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011021
OTP MISSION shRNA Lentiviral Transduction Particles
orthopedia homeobox
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011021.3-614s21c1
Sequence:CCGGCAAGTGGAAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTTCCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-628s1c1
Sequence:CCGGGCGCAAGAAGACCACCAACGTCTCGAGACGTTGGTGGTCTTCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-173s1c1
Sequence:CCGGGCCAGGCTAGGTATGAAAGATCTCGAGATCTTTCATACCTAGCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-284s1c1
Sequence:CCGGCCCAACTCGGACCCGGTCGAACTCGAGTTCGACCGGGTCCGAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-738s1c1
Sequence:CCGGGCCTGTGCTCTTTCCACGCCACTCGAGTGGCGTGGAAAGAGCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011021.1-493s1c1
Sequence:CCGGCAACGAATTGGAGAGGAGCTTCTCGAGAAGCTCCTCTCCAATTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011021.3-444s21c1
Sequence:CCGGCAACAGAAACAGAAGCGCCACCTCGAGGTGGCGCTTCTGTTTCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011021.3-886s21c1
Sequence:CCGGACTCCATGGGCTTGTCCAACACTCGAGTGTTGGACAAGCCCATGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)