EMAIL THIS PAGE TO A FRIEND

OTUD1

OTU domain containing 1

224 Gene Product Result for
Synonyms: DUBA7 OTDC1
UniProtKB ID: Q5VV17
Gene ID:
Human(220213) Summary: Deubiquitinating enzymes (DUBs; see MIM 603478) are proteases that specifically cleave ubiquitin (MIM 191339) linkages, negating the action of ubiquitin ligases. DUBA7 belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain.[supplied by OMIM, May 2008]
Mouse(71198) OTU domain containing 1
Rat(498803) OTU domain containing 1
domestic guinea pig(100716611) OTU domain containing 1
naked mole-rat(101702603) OTU domain containing 1
sheep(101114127) OTU domain containing 1
chicken(420502) OTU domain containing 1
dog(487102) OTU domain containing 1
cow(530173) OTU domain containing 1
domestic cat(101085218) OTU domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145373 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126001 MISSION® esiRNA esiRNA human OTUD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_166659 Rosetta Predictions human pricing
XR_040063 Rosetta Predictions human pricing
XR_040064 Rosetta Predictions human pricing
XR_040065 Rosetta Predictions human pricing
XM_001074167 Rosetta Predictions rat pricing
XM_574086 Rosetta Predictions rat pricing
XM_622877 Rosetta Predictions mouse pricing
XM_912498 Rosetta Predictions mouse pricing
XM_991213 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_166659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270248 predicted 2184
2 SASI_Hs01_00270249 predicted 2104
3 SASI_Hs01_00270250 predicted 2005
4 SASI_Hs01_00270251 predicted 2134
5 SASI_Hs01_00270252 predicted 1756
6 SASI_Hs01_00270253 predicted 1636
7 SASI_Hs01_00270254 predicted 1850
8 SASI_Hs01_00270255 predicted 1768
9 SASI_Hs01_00270256 predicted 1635
10 SASI_Hs01_00270257 predicted 1936
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515583 predicted 2053
2 SASI_Hs02_00515584 predicted 1976
3 SASI_Hs02_00515585 predicted 1878
4 SASI_Hs02_00515586 predicted 1250
5 SASI_Hs02_00515587 predicted 1634
6 SASI_Hs02_00515588 predicted 2170
7 SASI_Hs02_00515589 predicted 1506
8 SASI_Hs02_00515590 predicted 1717
9 SASI_Hs02_00515591 predicted 1647
10 SASI_Hs02_00515592 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515593 predicted 1899
2 SASI_Hs02_00515594 predicted 1816
3 SASI_Hs02_00515595 predicted 1722
4 SASI_Hs02_00515596 predicted 1100
5 SASI_Hs02_00515597 predicted 1479
6 SASI_Hs02_00515598 predicted 2014
7 SASI_Hs02_00515599 predicted 1364
8 SASI_Hs02_00515600 predicted 1567
9 SASI_Hs02_00515601 predicted 1491
10 SASI_Hs02_00515602 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515603 predicted 2291
2 SASI_Hs02_00515604 predicted 2213
3 SASI_Hs02_00515605 predicted 2115
4 SASI_Hs02_00515606 predicted 1493
5 SASI_Hs02_00515607 predicted 1872
6 SASI_Hs02_00515608 predicted 2413
7 SASI_Hs02_00515609 predicted 1752
8 SASI_Hs02_00515610 predicted 1958
9 SASI_Hs02_00515611 predicted 1885
10 SASI_Hs02_00515612 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345260 predicted 1508
2 SASI_Rn02_00345261 predicted 1714
3 SASI_Rn02_00345262 predicted 1762
4 SASI_Rn02_00345263 predicted 959
5 SASI_Rn02_00345264 predicted 1723
6 SASI_Rn02_00345265 predicted 970
7 SASI_Rn02_00345266 predicted 1604
8 SASI_Rn02_00345267 predicted 1665
9 SASI_Rn02_00345268 predicted 1202
10 SASI_Rn02_00345269 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401349 predicted 1930
2 SASI_Rn02_00401350 predicted 2126
3 SASI_Rn02_00401351 predicted 2178
4 SASI_Rn02_00401352 predicted 1369
5 SASI_Rn02_00401353 predicted 2147
6 SASI_Rn02_00401354 predicted 1390
7 SASI_Rn02_00401355 predicted 2020
8 SASI_Rn02_00401356 predicted 2077
9 SASI_Rn02_00401357 predicted 1622
10 SASI_Rn02_00401358 predicted 1669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427992 predicted 1286
2 SASI_Mm02_00427993 predicted 1239
3 SASI_Mm02_00427994 predicted 993
4 SASI_Mm02_00427995 predicted 1003
5 SASI_Mm02_00427996 predicted 645
6 SASI_Mm02_00427997 predicted 696
7 SASI_Mm02_00427998 predicted 350
8 SASI_Mm02_00427999 predicted 906
9 SASI_Mm02_00428000 predicted 607
10 SASI_Mm02_00428001 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437141 predicted 1283
2 SASI_Mm02_00437142 predicted 1234
3 SASI_Mm02_00437143 predicted 995
4 SASI_Mm02_00437144 predicted 998
5 SASI_Mm02_00437145 predicted 653
6 SASI_Mm02_00437146 predicted 697
7 SASI_Mm02_00437147 predicted 352
8 SASI_Mm02_00437148 predicted 910
9 SASI_Mm02_00437149 predicted 604
10 SASI_Mm02_00437150 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260172 predicted 1282
2 SASI_Mm01_00260173 predicted 1236
3 SASI_Mm01_00260174 predicted 989
4 SASI_Mm01_00260175 predicted 997
5 SASI_Mm01_00260176 predicted 644
6 SASI_Mm01_00260177 predicted 694
7 SASI_Mm01_00260178 predicted 353
8 SASI_Mm01_00260179 predicted 910
9 SASI_Mm01_00260180 predicted 607
10 SASI_Mm01_00260181 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145373
VALIDATED
OTUD1 MISSION shRNA Bacterial Glycerol Stock
OTU domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145373.2-1725s21c1
Sequence:CCGGTTCAAACTTGCTAGTAGATTTCTCGAGAAATCTACTAGCAAGTTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145373.2-1435s21c1
Sequence:CCGGGATTCCCTGAGGCCTAGTATTCTCGAGAATACTAGGCCTCAGGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145373.2-1351s21c1
Sequence:CCGGCTGAATGTGAATATCCATTTACTCGAGTAAATGGATATTCACATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145373.2-1160s21c1
Sequence:CCGGCTGTCAGCAAGACGGTGTATGCTCGAGCATACACCGTCTTGCTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145373.2-1401s21c1
Sequence:CCGGGGTGTCTACCATGATTCATTACTCGAGTAATGAATCATGGTAGACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145373
VALIDATED
OTUD1 MISSION shRNA shRNA Plasmid DNA
OTU domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145373.2-1725s21c1
Sequence:CCGGTTCAAACTTGCTAGTAGATTTCTCGAGAAATCTACTAGCAAGTTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145373.2-1435s21c1
Sequence:CCGGGATTCCCTGAGGCCTAGTATTCTCGAGAATACTAGGCCTCAGGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145373.2-1351s21c1
Sequence:CCGGCTGAATGTGAATATCCATTTACTCGAGTAAATGGATATTCACATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145373.2-1160s21c1
Sequence:CCGGCTGTCAGCAAGACGGTGTATGCTCGAGCATACACCGTCTTGCTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145373.2-1401s21c1
Sequence:CCGGGGTGTCTACCATGATTCATTACTCGAGTAATGAATCATGGTAGACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145373
VALIDATED
OTUD1 MISSION shRNA Lentiviral Transduction Particles
OTU domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145373.2-1725s21c1
Sequence:CCGGTTCAAACTTGCTAGTAGATTTCTCGAGAAATCTACTAGCAAGTTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145373.2-1435s21c1
Sequence:CCGGGATTCCCTGAGGCCTAGTATTCTCGAGAATACTAGGCCTCAGGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145373.2-1351s21c1
Sequence:CCGGCTGAATGTGAATATCCATTTACTCGAGTAAATGGATATTCACATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145373.2-1160s21c1
Sequence:CCGGCTGTCAGCAAGACGGTGTATGCTCGAGCATACACCGTCTTGCTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145373.2-1401s21c1
Sequence:CCGGGGTGTCTACCATGATTCATTACTCGAGTAATGAATCATGGTAGACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)