EMAIL THIS PAGE TO A FRIEND

OTUD6A

OTU domain containing 6A

63 Gene Product Result for
Synonyms: DUBA2 HSHIN6
UniProtKB ID: Q7L8S5, B2RPB7
Gene ID:
Human(139562) Summary: Deubiquitinating enzymes (DUBs; see MIM 603478) are proteases that specifically cleave ubiquitin (MIM 191339) linkages, negating the action of ubiquitin ligases. DUBA2 belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain.[supplied by OMIM, May 2008]
Mouse(408193) OTU domain containing 6A
Rat(302426) OTU domain containing 6A
dog(491937) OTU domain containing 6A
domestic cat(101087134) OTU domain containing 6A
cow(532172) OTU domain containing 6A
domestic guinea pig(100717004) OTU domain containing 6A
sheep(101121496) OTU domain containing 6A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_066765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_066765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_066765 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207320 Rosetta Predictions human pricing
XM_001069450 Rosetta Predictions rat pricing
XM_228584 Rosetta Predictions rat pricing
XM_486733 Rosetta Predictions mouse pricing
XM_986294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018704 predicted 238
2 SASI_Hs01_00018705 predicted 581
3 SASI_Hs01_00018707 predicted 444
4 SASI_Hs01_00018708 predicted 651
5 SASI_Hs01_00018709 predicted 617
6 SASI_Hs02_00373860 predicted 641
7 SASI_Hs01_00018710 predicted 227
8 SASI_Hs01_00018711 predicted 235
9 SASI_Hs01_00018712 predicted 480
10 SASI_Hs01_00018713 predicted 231
11 SASI_Hs01_00018706 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328117 predicted 479
2 SASI_Rn02_00328118 predicted 518
3 SASI_Rn02_00328119 predicted 477
4 SASI_Rn02_00328120 predicted 526
5 SASI_Rn02_00328121 predicted 211
6 SASI_Rn02_00328122 predicted 285
7 SASI_Rn02_00328123 predicted 535
8 SASI_Rn02_00328124 predicted 438
9 SASI_Rn02_00328125 predicted 624
10 SASI_Rn02_00328126 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385270 predicted 475
2 SASI_Rn02_00385271 predicted 519
3 SASI_Rn02_00385272 predicted 478
4 SASI_Rn02_00385273 predicted 525
5 SASI_Rn02_00385274 predicted 211
6 SASI_Rn02_00385275 predicted 286
7 SASI_Rn02_00385276 predicted 533
8 SASI_Rn02_00385277 predicted 438
9 SASI_Rn02_00385278 predicted 621
10 SASI_Rn02_00385279 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426910 predicted 521
2 SASI_Mm02_00426911 predicted 517
3 SASI_Mm02_00426912 predicted 601
4 SASI_Mm02_00426913 predicted 624
5 SASI_Mm02_00426914 predicted 598
6 SASI_Mm02_00426915 predicted 436
7 SASI_Mm02_00426916 predicted 226
8 SASI_Mm02_00426917 predicted 285
9 SASI_Mm02_00426918 predicted 358
10 SASI_Mm02_00426919 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449065 predicted 442
2 SASI_Mm02_00449066 predicted 218
3 SASI_Mm02_00449067 predicted 223
4 SASI_Mm02_00449068 predicted 280
5 SASI_Mm02_00449069 predicted 338
6 SASI_Mm02_00449070 predicted 366
7 SASI_Mm02_00449071 predicted 203
8 SASI_Mm02_00449072 predicted 227
9 SASI_Mm02_00449073 predicted 295
10 SASI_Mm02_00449074 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163191
OTUD6A MISSION shRNA Bacterial Glycerol Stock
OTU domain containing 6A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-530s21c1
Sequence:CCGGACTACATGCGGAAACATATTGCTCGAGCAATATGTTTCCGCATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-67s21c1
Sequence:CCGGCAAGCACACATCCAGACTTTGCTCGAGCAAAGTCTGGATGTGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-614s21c1
Sequence:CCGGTGAGGTACTGTGATGACATTGCTCGAGCAATGTCATCACAGTACCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-93s21c1
Sequence:CCGGTTCCGTCCCAAAGAACGACAACTCGAGTTGTCGTTCTTTGGGACGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-214s21c1
Sequence:CCGGAGCAGTGTGGATTCGGTTACACTCGAGTGTAACCGAATCCACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163191
OTUD6A MISSION shRNA shRNA Plasmid DNA
OTU domain containing 6A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-530s21c1
Sequence:CCGGACTACATGCGGAAACATATTGCTCGAGCAATATGTTTCCGCATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-67s21c1
Sequence:CCGGCAAGCACACATCCAGACTTTGCTCGAGCAAAGTCTGGATGTGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-614s21c1
Sequence:CCGGTGAGGTACTGTGATGACATTGCTCGAGCAATGTCATCACAGTACCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-93s21c1
Sequence:CCGGTTCCGTCCCAAAGAACGACAACTCGAGTTGTCGTTCTTTGGGACGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-214s21c1
Sequence:CCGGAGCAGTGTGGATTCGGTTACACTCGAGTGTAACCGAATCCACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163191
OTUD6A MISSION shRNA Lentiviral Transduction Particles
OTU domain containing 6A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-530s21c1
Sequence:CCGGACTACATGCGGAAACATATTGCTCGAGCAATATGTTTCCGCATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-67s21c1
Sequence:CCGGCAAGCACACATCCAGACTTTGCTCGAGCAAAGTCTGGATGTGTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-614s21c1
Sequence:CCGGTGAGGTACTGTGATGACATTGCTCGAGCAATGTCATCACAGTACCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-93s21c1
Sequence:CCGGTTCCGTCCCAAAGAACGACAACTCGAGTTGTCGTTCTTTGGGACGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163191.1-214s21c1
Sequence:CCGGAGCAGTGTGGATTCGGTTACACTCGAGTGTAACCGAATCCACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_066765
OTUD6A MISSION shRNA Bacterial Glycerol Stock
OTU domain containing 6A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-238s1c1
Sequence:CCGGCGACAGTAGCATTGAATCTGTCTCGAGACAGATTCAATGCTACTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-631s1c1
Sequence:CCGGCTACGACGACTTCATGATCTACTCGAGTAGATCATGAAGTCGTCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-643s1c1
Sequence:CCGGCATGATCTACTGCGACAACATCTCGAGATGTTGTCGCAGTAGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_066765.4-1207s1c1
Sequence:CCGGGATTTGGTCATGTTGCGTATACTCGAGTATACGCAACATGACCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_066765.4-1197s1c1
Sequence:CCGGCACCAACTAAGATTTGGTCATCTCGAGATGACCAAATCTTAGTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-224s1c1
Sequence:CCGGGAGAAGTTCCAAGACGACAGTCTCGAGACTGTCGTCTTGGAACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_066765.4-1076s1c1
Sequence:CCGGGAAACGAAATTCGAGGGAAATCTCGAGATTTCCCTCGAATTTCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_066765
OTUD6A MISSION shRNA shRNA Plasmid DNA
OTU domain containing 6A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-238s1c1
Sequence:CCGGCGACAGTAGCATTGAATCTGTCTCGAGACAGATTCAATGCTACTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-631s1c1
Sequence:CCGGCTACGACGACTTCATGATCTACTCGAGTAGATCATGAAGTCGTCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-643s1c1
Sequence:CCGGCATGATCTACTGCGACAACATCTCGAGATGTTGTCGCAGTAGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_066765.4-1207s1c1
Sequence:CCGGGATTTGGTCATGTTGCGTATACTCGAGTATACGCAACATGACCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_066765.4-1197s1c1
Sequence:CCGGCACCAACTAAGATTTGGTCATCTCGAGATGACCAAATCTTAGTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-224s1c1
Sequence:CCGGGAGAAGTTCCAAGACGACAGTCTCGAGACTGTCGTCTTGGAACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_066765.4-1076s1c1
Sequence:CCGGGAAACGAAATTCGAGGGAAATCTCGAGATTTCCCTCGAATTTCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_066765
OTUD6A MISSION shRNA Lentiviral Transduction Particles
OTU domain containing 6A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-238s1c1
Sequence:CCGGCGACAGTAGCATTGAATCTGTCTCGAGACAGATTCAATGCTACTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-631s1c1
Sequence:CCGGCTACGACGACTTCATGATCTACTCGAGTAGATCATGAAGTCGTCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-643s1c1
Sequence:CCGGCATGATCTACTGCGACAACATCTCGAGATGTTGTCGCAGTAGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_066765.4-1207s1c1
Sequence:CCGGGATTTGGTCATGTTGCGTATACTCGAGTATACGCAACATGACCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_066765.4-1197s1c1
Sequence:CCGGCACCAACTAAGATTTGGTCATCTCGAGATGACCAAATCTTAGTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066765.4-224s1c1
Sequence:CCGGGAGAAGTTCCAAGACGACAGTCTCGAGACTGTCGTCTTGGAACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_066765.4-1076s1c1
Sequence:CCGGGAAACGAAATTCGAGGGAAATCTCGAGATTTCCCTCGAATTTCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)