EMAIL THIS PAGE TO A FRIEND

OTX1

orthodenticle homeobox 1

128 Gene Product Result for
UniProtKB ID: P32242, A6NHA2, B3KTJ4, Q53TG6
Gene ID:
Human(5013) Summary: This gene encodes a member of the bicoid sub-family of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and may play a role in brain and sensory organ development. A similar protein in mouse is required for proper brain and sensory organ development and can cause epilepsy. Alternate splicing results in two transcript variants that encoded the same protein.[provided by RefSeq, Dec 2010]
Mouse(18423) orthodenticle homolog 1 (Drosophila)
Rat(25646) orthodenticle homeobox 1
chicken(100858585) orthodenticle homeobox 1
cow(540628) orthodenticle homeobox 1
domestic cat(101085540) orthodenticle homeobox 1
dog(610347) orthodenticle homeobox 1
naked mole-rat(101721000) orthodenticle homeobox 1
domestic guinea pig(100735634) orthodenticle homeobox 1
sheep(101116465) orthodenticle homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100438 Anti-OTX1 (221-235) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100437 Anti-OTX1 (97-110) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV32396 Anti-OTX1 (AB1) antibody produced in rabbit affinity isolated antibody mouse, horse, rat, rabbit, bovine, canine, guinea pig, human
western blot pricing
AV100957 Anti-OTX1 (AB2) antibody produced in rabbit affinity isolated antibody bovine, mouse, guinea pig, human, rat, canine, zebrafish
western blot pricing
AV100958 Anti-OTX1 (AB3) antibody produced in rabbit affinity isolated antibody human, bovine, guinea pig, rabbit, mouse, rat, zebrafish, canine
western blot pricing
SAB1412057 ANTI-OTX1 antibody produced in mouse clone 4E5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412058 ANTI-OTX1 antibody produced in mouse clone 3A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
AV39103 Anti-OTX1 antibody produced in rabbit IgG fraction of antiserum human, mouse, horse, bovine, rat, canine
western blot pricing
HPA052122 Anti-OTX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2103409 Anti-OTX1, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, human, zebrafish, sheep, canine, horse, rat, guinea pig, mouse, rabbit
western blot pricing
WH0005013M1 Monoclonal Anti-OTX1 antibody produced in mouse clone 1F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404158 Monoclonal Anti-OTX1 antibody produced in mouse clone 3D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014562 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU075761 MISSION® esiRNA esiRNA targeting mouse Otx1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014562 Rosetta Predictions human pricing
NM_013109 Rosetta Predictions rat pricing
NM_011023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166939 predicted 604
2 SASI_Hs01_00166940 predicted 1760
3 SASI_Hs01_00166941 predicted 1666
4 SASI_Hs02_00345824 predicted 1387
5 SASI_Hs02_00345825 predicted 1617
6 SASI_Hs01_00166942 predicted 1527
7 SASI_Hs01_00166943 predicted 621
8 SASI_Hs01_00166945 predicted 417
9 SASI_Hs01_00166946 predicted 832
10 SASI_Hs01_00166947 predicted 592
11 SASI_Hs01_00166938 predicted 1686
12 SASI_Hs01_00166944 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063930 predicted 547
2 SASI_Rn01_00063931 predicted 609
3 SASI_Rn01_00063932 predicted 581
4 SASI_Rn02_00260884 predicted 322
5 SASI_Rn01_00063933 predicted 220
6 SASI_Rn01_00063934 predicted 432
7 SASI_Rn01_00063935 predicted 604
8 SASI_Rn01_00063936 predicted 428
9 SASI_Rn01_00063937 predicted 269
10 SASI_Rn01_00063938 predicted 356
11 SASI_Rn01_00063929 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034199 predicted 1770
2 SASI_Mm01_00034200 predicted 1615
3 SASI_Mm01_00034201 predicted 1777
4 SASI_Mm01_00034202 predicted 1753
5 SASI_Mm01_00034203 predicted 1571
6 SASI_Mm01_00034204 predicted 312
7 SASI_Mm01_00034205 predicted 786
8 SASI_Mm01_00034206 predicted 666
9 SASI_Mm01_00034207 predicted 667
10 SASI_Mm01_00034208 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011023
OTX1 MISSION shRNA Bacterial Glycerol Stock
orthodenticle homeobox 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011023.3-1752s21c1
Sequence:CCGGAGTCACTAACTGGCGTATATCCTCGAGGATATACGCCAGTTAGTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011023.3-1588s21c1
Sequence:CCGGCCTCCGTTTCTTCCCGGAATACTCGAGTATTCCGGGAAGAAACGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011023.2-2055s1c1
Sequence:CCGGGCGTCCAAGAAACAGAACTTTCTCGAGAAAGTTCTGTTTCTTGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-1174s1c1
Sequence:CCGGTCGCCTTCAATTCTGCCGATTCTCGAGAATCGGCAGAATTGAAGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-963s1c1
Sequence:CCGGTCTTCTTACTTTGGCGGTGTACTCGAGTACACCGCCAAAGTAAGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-1177s1c1
Sequence:CCGGCCTTCAATTCTGCCGATTGCTCTCGAGAGCAATCGGCAGAATTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-637s1c1
Sequence:CCGGCCGTATCTAGCTCTGCTTCTTCTCGAGAAGAAGCAGAGCTAGATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011023
OTX1 MISSION shRNA shRNA Plasmid DNA
orthodenticle homeobox 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011023.3-1752s21c1
Sequence:CCGGAGTCACTAACTGGCGTATATCCTCGAGGATATACGCCAGTTAGTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011023.3-1588s21c1
Sequence:CCGGCCTCCGTTTCTTCCCGGAATACTCGAGTATTCCGGGAAGAAACGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011023.2-2055s1c1
Sequence:CCGGGCGTCCAAGAAACAGAACTTTCTCGAGAAAGTTCTGTTTCTTGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-1174s1c1
Sequence:CCGGTCGCCTTCAATTCTGCCGATTCTCGAGAATCGGCAGAATTGAAGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-963s1c1
Sequence:CCGGTCTTCTTACTTTGGCGGTGTACTCGAGTACACCGCCAAAGTAAGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-1177s1c1
Sequence:CCGGCCTTCAATTCTGCCGATTGCTCTCGAGAGCAATCGGCAGAATTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-637s1c1
Sequence:CCGGCCGTATCTAGCTCTGCTTCTTCTCGAGAAGAAGCAGAGCTAGATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011023
OTX1 MISSION shRNA Lentiviral Transduction Particles
orthodenticle homeobox 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011023.3-1752s21c1
Sequence:CCGGAGTCACTAACTGGCGTATATCCTCGAGGATATACGCCAGTTAGTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011023.3-1588s21c1
Sequence:CCGGCCTCCGTTTCTTCCCGGAATACTCGAGTATTCCGGGAAGAAACGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011023.2-2055s1c1
Sequence:CCGGGCGTCCAAGAAACAGAACTTTCTCGAGAAAGTTCTGTTTCTTGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-1174s1c1
Sequence:CCGGTCGCCTTCAATTCTGCCGATTCTCGAGAATCGGCAGAATTGAAGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-963s1c1
Sequence:CCGGTCTTCTTACTTTGGCGGTGTACTCGAGTACACCGCCAAAGTAAGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-1177s1c1
Sequence:CCGGCCTTCAATTCTGCCGATTGCTCTCGAGAGCAATCGGCAGAATTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011023.2-637s1c1
Sequence:CCGGCCGTATCTAGCTCTGCTTCTTCTCGAGAAGAAGCAGAGCTAGATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014562
VALIDATED
OTX1 MISSION shRNA Bacterial Glycerol Stock
orthodenticle homeobox 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014562.2-1622s21c1
Sequence:CCGGGTCTTTCTGGACAGCTATTAACTCGAGTTAATAGCTGTCCAGAAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-608s21c1
Sequence:CCGGCTCCGAAAGCAGTGGCCAATTCTCGAGAATTGGCCACTGCTTTCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-756s21c1
Sequence:CCGGACACCAGCTGCCTCATCTATCCTCGAGGATAGATGAGGCAGCTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-1260s21c1
Sequence:CCGGCCCGACTGTCTGGACTATAAGCTCGAGCTTATAGTCCAGACAGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-846s21c1
Sequence:CCGGCCTAGCAACACCTCGTGTATGCTCGAGCATACACGAGGTGTTGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014562.2-1619s1c1
Sequence:CCGGCCAGTCTTTCTGGACAGCTATCTCGAGATAGCTGTCCAGAAAGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_014562.2-1002s1c1
Sequence:CCGGCTAGCGCCCATGCACTCACATCTCGAGATGTGAGTGCATGGGCGCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_014562.2-570s1c1
Sequence:CCGGGCCAAGAAGAAGTCCTCTCCACTCGAGTGGAGAGGACTTCTTCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014562.2-1266s1c1
Sequence:CCGGTGTCTGGACTATAAGGACCAACTCGAGTTGGTCCTTATAGTCCAGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014562.2-845s1c1
Sequence:CCGGGCCTAGCAACACCTCGTGTATCTCGAGATACACGAGGTGTTGCTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014562
VALIDATED
OTX1 MISSION shRNA shRNA Plasmid DNA
orthodenticle homeobox 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014562.2-1622s21c1
Sequence:CCGGGTCTTTCTGGACAGCTATTAACTCGAGTTAATAGCTGTCCAGAAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-608s21c1
Sequence:CCGGCTCCGAAAGCAGTGGCCAATTCTCGAGAATTGGCCACTGCTTTCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-756s21c1
Sequence:CCGGACACCAGCTGCCTCATCTATCCTCGAGGATAGATGAGGCAGCTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-1260s21c1
Sequence:CCGGCCCGACTGTCTGGACTATAAGCTCGAGCTTATAGTCCAGACAGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-846s21c1
Sequence:CCGGCCTAGCAACACCTCGTGTATGCTCGAGCATACACGAGGTGTTGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014562.2-1619s1c1
Sequence:CCGGCCAGTCTTTCTGGACAGCTATCTCGAGATAGCTGTCCAGAAAGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_014562.2-1002s1c1
Sequence:CCGGCTAGCGCCCATGCACTCACATCTCGAGATGTGAGTGCATGGGCGCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_014562.2-570s1c1
Sequence:CCGGGCCAAGAAGAAGTCCTCTCCACTCGAGTGGAGAGGACTTCTTCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014562.2-1266s1c1
Sequence:CCGGTGTCTGGACTATAAGGACCAACTCGAGTTGGTCCTTATAGTCCAGACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014562.2-845s1c1
Sequence:CCGGGCCTAGCAACACCTCGTGTATCTCGAGATACACGAGGTGTTGCTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014562
VALIDATED
OTX1 MISSION shRNA Lentiviral Transduction Particles
orthodenticle homeobox 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014562.2-1622s21c1
Sequence:CCGGGTCTTTCTGGACAGCTATTAACTCGAGTTAATAGCTGTCCAGAAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-608s21c1
Sequence:CCGGCTCCGAAAGCAGTGGCCAATTCTCGAGAATTGGCCACTGCTTTCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-756s21c1
Sequence:CCGGACACCAGCTGCCTCATCTATCCTCGAGGATAGATGAGGCAGCTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-1260s21c1
Sequence:CCGGCCCGACTGTCTGGACTATAAGCTCGAGCTTATAGTCCAGACAGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014562.2-846s21c1
Sequence:CCGGCCTAGCAACACCTCGTGTATGCTCGAGCATACACGAGGTGTTGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014562.2-1619s1c1
Sequence:CCGGCCAGTCTTTCTGGACAGCTATCTCGAGATAGCTGTCCAGAAAGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_014562.2-1002s1c1
Sequence:CCGGCTAGCGCCCATGCACTCACATCTCGAGATGTGAGTGCATGGGCGCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_014562.2-570s1c1
Sequence:CCGGGCCAAGAAGAAGTCCTCTCCACTCGAGTGGAGAGGACTTCTTCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014562.2-1266s1c1
Sequence:CCGGTGTCTGGACTATAAGGACCAACTCGAGTTGGTCCTTATAGTCCAGACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014562.2-845s1c1
Sequence:CCGGGCCTAGCAACACCTCGTGTATCTCGAGATACACGAGGTGTTGCTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)