EMAIL THIS PAGE TO A FRIEND

OVCA2

ovarian tumor suppressor candidate 2

50 Gene Product Result for
UniProtKB ID: Q8WZ82, Q86XN3, Q8IW87, Q9UCX9
Gene ID:
Mouse(246257) candidate tumor suppressor in ovarian cancer 2
Rat(497954) ovarian tumor suppressor candidate 2
naked mole-rat(101699871) ovarian tumor suppressor candidate 2
domestic guinea pig(101788495) ovarian tumor suppressor candidate 2
Zebrafish(553576) ovarian tumor suppressor candidate 2
dog(611290) ovarian tumor suppressor candidate 2
domestic cat(101099669) ovarian tumor suppressor candidate 2
cow(513845) ovarian tumor suppressor candidate 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080822 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080822 Rosetta Predictions human pricing
NM_001109036 Rosetta Predictions rat pricing
NM_027136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047390 predicted 662
2 SASI_Hs01_00047391 predicted 560
3 SASI_Hs01_00047392 predicted 622
4 SASI_Hs01_00047393 predicted 488
5 SASI_Hs02_00362598 predicted 613
6 SASI_Hs01_00047395 predicted 486
7 SASI_Hs01_00047397 predicted 485
8 SASI_Hs01_00047398 predicted 727
9 SASI_Hs01_00047399 predicted 560
10 SASI_Hs02_00362599 predicted 767
11 SASI_Hs01_00047394 predicted 491
12 SASI_Hs01_00047396 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244544 predicted 1041
2 SASI_Rn02_00244545 predicted 506
3 SASI_Rn02_00244546 predicted 557
4 SASI_Rn02_00244547 predicted 680
5 SASI_Rn02_00244548 predicted 681
6 SASI_Rn02_00244549 predicted 1105
7 SASI_Rn02_00244550 predicted 659
8 SASI_Rn02_00244551 predicted 434
9 SASI_Rn02_00244552 predicted 1051
10 SASI_Rn02_00244553 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082175 predicted 371
2 SASI_Mm01_00082176 predicted 868
3 SASI_Mm01_00082177 predicted 1068
4 SASI_Mm01_00082179 predicted 685
5 SASI_Mm01_00082181 predicted 654
6 SASI_Mm01_00082182 predicted 750
7 SASI_Mm01_00082183 predicted 432
8 SASI_Mm01_00082184 predicted 923
9 SASI_Mm02_00331635 predicted 546
10 SASI_Mm02_00331636 predicted 1074
11 SASI_Mm01_00082178 predicted 502
12 SASI_Mm01_00082180 predicted 1055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027136
VALIDATED
OVCA2 MISSION shRNA Bacterial Glycerol Stock
ovarian tumor suppressor candidate 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027136.3-612s21c1
Sequence:CCGGACTCCGGTGGTCACTTCATTCCTCGAGGAATGAAGTGACCACCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-1048s21c1
Sequence:CCGGTTCAACCATGTGGGTTCTTTCCTCGAGGAAAGAACCCACATGGTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-1150s21c1
Sequence:CCGGCAGACTGAAGAAGCTAGATATCTCGAGATATCTAGCTTCTTCAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-976s21c1
Sequence:CCGGATCTTTAAATTCGGCTTATTGCTCGAGCAATAAGCCGAATTTAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-1163s21c1
Sequence:CCGGCTAGATATCTTGGTCACTTAGCTCGAGCTAAGTGACCAAGATATCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-949s21c1
Sequence:CCGGTTTGGTGGAAGTCATTTATTGCTCGAGCAATAAATGACTTCCACCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027136.3-569s21c1
Sequence:CCGGATGCAATTGGCTAGCCGATTCCTCGAGGAATCGGCTAGCCAATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027136.3-684s21c1
Sequence:CCGGCAGAATGAAGGATGGACAAATCTCGAGATTTGTCCATCCTTCATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027136.2-79s1c1
Sequence:CCGGCCGTGAGAAGACCGGAGCGCTCTCGAGAGCGCTCCGGTCTTCTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027136.2-870s1c1
Sequence:CCGGGCGATGCTTTAGATGTTGAATCTCGAGATTCAACATCTAAAGCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027136.2-661s1c1
Sequence:CCGGCCTTAAGTTCTTGGACCAGTTCTCGAGAACTGGTCCAAGAACTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027136.2-431s1c1
Sequence:CCGGCCCTTGCCAAGATTTATTATACTCGAGTATAATAAATCTTGGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027136
VALIDATED
OVCA2 MISSION shRNA shRNA Plasmid DNA
ovarian tumor suppressor candidate 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027136.3-612s21c1
Sequence:CCGGACTCCGGTGGTCACTTCATTCCTCGAGGAATGAAGTGACCACCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-1048s21c1
Sequence:CCGGTTCAACCATGTGGGTTCTTTCCTCGAGGAAAGAACCCACATGGTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-1150s21c1
Sequence:CCGGCAGACTGAAGAAGCTAGATATCTCGAGATATCTAGCTTCTTCAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-976s21c1
Sequence:CCGGATCTTTAAATTCGGCTTATTGCTCGAGCAATAAGCCGAATTTAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-1163s21c1
Sequence:CCGGCTAGATATCTTGGTCACTTAGCTCGAGCTAAGTGACCAAGATATCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-949s21c1
Sequence:CCGGTTTGGTGGAAGTCATTTATTGCTCGAGCAATAAATGACTTCCACCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027136.3-569s21c1
Sequence:CCGGATGCAATTGGCTAGCCGATTCCTCGAGGAATCGGCTAGCCAATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027136.3-684s21c1
Sequence:CCGGCAGAATGAAGGATGGACAAATCTCGAGATTTGTCCATCCTTCATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027136.2-79s1c1
Sequence:CCGGCCGTGAGAAGACCGGAGCGCTCTCGAGAGCGCTCCGGTCTTCTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027136.2-870s1c1
Sequence:CCGGGCGATGCTTTAGATGTTGAATCTCGAGATTCAACATCTAAAGCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027136.2-661s1c1
Sequence:CCGGCCTTAAGTTCTTGGACCAGTTCTCGAGAACTGGTCCAAGAACTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027136.2-431s1c1
Sequence:CCGGCCCTTGCCAAGATTTATTATACTCGAGTATAATAAATCTTGGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027136
VALIDATED
OVCA2 MISSION shRNA Lentiviral Transduction Particles
ovarian tumor suppressor candidate 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027136.3-612s21c1
Sequence:CCGGACTCCGGTGGTCACTTCATTCCTCGAGGAATGAAGTGACCACCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-1048s21c1
Sequence:CCGGTTCAACCATGTGGGTTCTTTCCTCGAGGAAAGAACCCACATGGTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-1150s21c1
Sequence:CCGGCAGACTGAAGAAGCTAGATATCTCGAGATATCTAGCTTCTTCAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-976s21c1
Sequence:CCGGATCTTTAAATTCGGCTTATTGCTCGAGCAATAAGCCGAATTTAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-1163s21c1
Sequence:CCGGCTAGATATCTTGGTCACTTAGCTCGAGCTAAGTGACCAAGATATCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027136.3-949s21c1
Sequence:CCGGTTTGGTGGAAGTCATTTATTGCTCGAGCAATAAATGACTTCCACCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027136.3-569s21c1
Sequence:CCGGATGCAATTGGCTAGCCGATTCCTCGAGGAATCGGCTAGCCAATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027136.3-684s21c1
Sequence:CCGGCAGAATGAAGGATGGACAAATCTCGAGATTTGTCCATCCTTCATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027136.2-79s1c1
Sequence:CCGGCCGTGAGAAGACCGGAGCGCTCTCGAGAGCGCTCCGGTCTTCTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027136.2-870s1c1
Sequence:CCGGGCGATGCTTTAGATGTTGAATCTCGAGATTCAACATCTAAAGCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027136.2-661s1c1
Sequence:CCGGCCTTAAGTTCTTGGACCAGTTCTCGAGAACTGGTCCAAGAACTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027136.2-431s1c1
Sequence:CCGGCCCTTGCCAAGATTTATTATACTCGAGTATAATAAATCTTGGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080822
VALIDATED
OVCA2 MISSION shRNA Bacterial Glycerol Stock
ovarian tumor suppressor candidate 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_080822.2-863s21c1
Sequence:CCGGGTTAAGAGACAACTATCAATTCTCGAGAATTGATAGTTGTCTCTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080822.2-552s21c1
Sequence:CCGGCTGCAAAGGCCCTTGTCATTGCTCGAGCAATGACAAGGGCCTTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_080822.2-670s21c1
Sequence:CCGGACTCTGGTGGCCACTTCATTCCTCGAGGAATGAAGTGGCCACCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080822.2-628s21c1
Sequence:CCGGTGCAACTGGCCAGCCAATTTCCTCGAGGAAATTGGCTGGCCAGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-170s1c1
Sequence:CCGGCCAGATCAGACTTCGGGTCCTCTCGAGAGGACCCGAAGTCTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-427s1c1
Sequence:CCGGCGGTTTATCCTCTTGGTGTCTCTCGAGAGACACCAAGAGGATAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-547s1c1
Sequence:CCGGCCCTCTCAGGAGAGTGTGCAACTCGAGTTGCACACTCTCCTGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-465s1c1
Sequence:CCGGCATTGGGTTCAAGGAATCCATCTCGAGATGGATTCCTTGAACCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-654s1c1
Sequence:CCGGCCTCAAGTTCTTGGACCAGTTCTCGAGAACTGGTCCAAGAACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080822
VALIDATED
OVCA2 MISSION shRNA shRNA Plasmid DNA
ovarian tumor suppressor candidate 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_080822.2-863s21c1
Sequence:CCGGGTTAAGAGACAACTATCAATTCTCGAGAATTGATAGTTGTCTCTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080822.2-552s21c1
Sequence:CCGGCTGCAAAGGCCCTTGTCATTGCTCGAGCAATGACAAGGGCCTTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_080822.2-670s21c1
Sequence:CCGGACTCTGGTGGCCACTTCATTCCTCGAGGAATGAAGTGGCCACCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080822.2-628s21c1
Sequence:CCGGTGCAACTGGCCAGCCAATTTCCTCGAGGAAATTGGCTGGCCAGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-170s1c1
Sequence:CCGGCCAGATCAGACTTCGGGTCCTCTCGAGAGGACCCGAAGTCTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-427s1c1
Sequence:CCGGCGGTTTATCCTCTTGGTGTCTCTCGAGAGACACCAAGAGGATAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-547s1c1
Sequence:CCGGCCCTCTCAGGAGAGTGTGCAACTCGAGTTGCACACTCTCCTGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-465s1c1
Sequence:CCGGCATTGGGTTCAAGGAATCCATCTCGAGATGGATTCCTTGAACCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-654s1c1
Sequence:CCGGCCTCAAGTTCTTGGACCAGTTCTCGAGAACTGGTCCAAGAACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080822
VALIDATED
OVCA2 MISSION shRNA Lentiviral Transduction Particles
ovarian tumor suppressor candidate 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_080822.2-863s21c1
Sequence:CCGGGTTAAGAGACAACTATCAATTCTCGAGAATTGATAGTTGTCTCTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080822.2-552s21c1
Sequence:CCGGCTGCAAAGGCCCTTGTCATTGCTCGAGCAATGACAAGGGCCTTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_080822.2-670s21c1
Sequence:CCGGACTCTGGTGGCCACTTCATTCCTCGAGGAATGAAGTGGCCACCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080822.2-628s21c1
Sequence:CCGGTGCAACTGGCCAGCCAATTTCCTCGAGGAAATTGGCTGGCCAGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-170s1c1
Sequence:CCGGCCAGATCAGACTTCGGGTCCTCTCGAGAGGACCCGAAGTCTGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-427s1c1
Sequence:CCGGCGGTTTATCCTCTTGGTGTCTCTCGAGAGACACCAAGAGGATAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-547s1c1
Sequence:CCGGCCCTCTCAGGAGAGTGTGCAACTCGAGTTGCACACTCTCCTGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-465s1c1
Sequence:CCGGCATTGGGTTCAAGGAATCCATCTCGAGATGGATTCCTTGAACCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_080822.1-654s1c1
Sequence:CCGGCCTCAAGTTCTTGGACCAGTTCTCGAGAACTGGTCCAAGAACTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)