EMAIL THIS PAGE TO A FRIEND

OVCH1

ovochymase 1

21 Gene Product Result for
Synonyms: OVCH
UniProtKB ID: Q7RTY7
Gene ID:
dog(490054) serine protease 27-like
cow(518980) ovochymase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183378 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029311 MISSION® esiRNA esiRNA human OVCH1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183378 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076572 predicted 1959
2 SASI_Hs02_00371286 predicted 2374
3 SASI_Hs01_00076575 predicted 1296
4 SASI_Hs01_00076576 predicted 2824
5 SASI_Hs01_00076577 predicted 2817
6 SASI_Hs01_00076578 predicted 410
7 SASI_Hs01_00076579 predicted 2763
8 SASI_Hs01_00076580 predicted 2904
9 SASI_Hs01_00076581 predicted 374
10 SASI_Hs02_00371287 predicted 1504
11 SASI_Hs01_00076573 predicted 2233
12 SASI_Hs01_00076574 predicted 3046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183378
OVCH1 MISSION shRNA Bacterial Glycerol Stock
ovochymase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183378.2-1985s21c1
Sequence:CCGGACTCTGACATTGCCCTAATACCTCGAGGTATTAGGGCAATGTCAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183378.2-1515s21c1
Sequence:CCGGTAGTAACATGACGGTGATATACTCGAGTATATCACCGTCATGTTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-2581s1c1
Sequence:CCGGCCACGGTATCTACTGGATTATCTCGAGATAATCCAGTAGATACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-804s1c1
Sequence:CCGGCGTAAGAAACAACCATGTGAACTCGAGTTCACATGGTTGTTTCTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-2582s1c1
Sequence:CCGGCACGGTATCTACTGGATTATACTCGAGTATAATCCAGTAGATACCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-1430s1c1
Sequence:CCGGCTGTTGTGATTTACGGTGATTCTCGAGAATCACCGTAAATCACAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-1322s1c1
Sequence:CCGGCCAGTAACACAAGGTGTCATTCTCGAGAATGACACCTTGTGTTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183378
OVCH1 MISSION shRNA shRNA Plasmid DNA
ovochymase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183378.2-1985s21c1
Sequence:CCGGACTCTGACATTGCCCTAATACCTCGAGGTATTAGGGCAATGTCAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183378.2-1515s21c1
Sequence:CCGGTAGTAACATGACGGTGATATACTCGAGTATATCACCGTCATGTTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-2581s1c1
Sequence:CCGGCCACGGTATCTACTGGATTATCTCGAGATAATCCAGTAGATACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-804s1c1
Sequence:CCGGCGTAAGAAACAACCATGTGAACTCGAGTTCACATGGTTGTTTCTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-2582s1c1
Sequence:CCGGCACGGTATCTACTGGATTATACTCGAGTATAATCCAGTAGATACCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-1430s1c1
Sequence:CCGGCTGTTGTGATTTACGGTGATTCTCGAGAATCACCGTAAATCACAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-1322s1c1
Sequence:CCGGCCAGTAACACAAGGTGTCATTCTCGAGAATGACACCTTGTGTTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183378
OVCH1 MISSION shRNA Lentiviral Transduction Particles
ovochymase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183378.2-1985s21c1
Sequence:CCGGACTCTGACATTGCCCTAATACCTCGAGGTATTAGGGCAATGTCAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183378.2-1515s21c1
Sequence:CCGGTAGTAACATGACGGTGATATACTCGAGTATATCACCGTCATGTTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-2581s1c1
Sequence:CCGGCCACGGTATCTACTGGATTATCTCGAGATAATCCAGTAGATACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-804s1c1
Sequence:CCGGCGTAAGAAACAACCATGTGAACTCGAGTTCACATGGTTGTTTCTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-2582s1c1
Sequence:CCGGCACGGTATCTACTGGATTATACTCGAGTATAATCCAGTAGATACCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-1430s1c1
Sequence:CCGGCTGTTGTGATTTACGGTGATTCTCGAGAATCACCGTAAATCACAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183378.1-1322s1c1
Sequence:CCGGCCAGTAACACAAGGTGTCATTCTCGAGAATGACACCTTGTGTTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)