EMAIL THIS PAGE TO A FRIEND

OVCH2

ovochymase 2 (gene/pseudogene)

54 Gene Product Result for
Synonyms: OVTN
UniProtKB ID: Q7RTZ1
Gene ID:
Mouse(244199) ovochymase 2
Rat(308919) ovochymase 2
chicken(769290) ovochymase 2
cow(782899) ovochymase 2
dog(485368) ovochymase 2
sheep(101111574) ovochymase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198185 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101581 MISSION® esiRNA esiRNA human U66060.1 (esiRNA2) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198185 Rosetta Predictions human pricing
XM_219202 Rosetta Predictions rat pricing
XR_009080 Rosetta Predictions rat pricing
NM_172908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371725 predicted 1218
2 SASI_Hs01_00020541 predicted 364
3 SASI_Hs01_00020542 predicted 720
4 SASI_Hs01_00020543 predicted 1098
5 SASI_Hs01_00020544 predicted 1387
6 SASI_Hs01_00020545 predicted 413
7 SASI_Hs02_00371726 predicted 1104
8 SASI_Hs02_00371727 predicted 1395
9 SASI_Hs01_00020546 predicted 1320
10 SASI_Hs01_00020547 predicted 401
11 SASI_Hs01_00020548 predicted 1274
12 SASI_Hs01_00020549 predicted 1213
13 SASI_Hs01_00020550 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154979 predicted 1300
2 SASI_Rn01_00154980 predicted 1188
3 SASI_Rn01_00154981 predicted 1059
4 SASI_Rn01_00154982 predicted 506
5 SASI_Rn01_00154983 predicted 288
6 SASI_Rn01_00154984 predicted 467
7 SASI_Rn01_00154985 predicted 1063
8 SASI_Rn01_00154986 predicted 1327
9 SASI_Rn01_00154987 predicted 1175
10 SASI_Rn01_00154988 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00128583 predicted 1292
2 SASI_Rn01_00128584 predicted 1184
3 SASI_Rn01_00128585 predicted 1051
4 SASI_Rn02_00418716 predicted 1310
5 SASI_Rn01_00128586 predicted 504
6 SASI_Rn01_00128588 predicted 456
7 SASI_Rn01_00128589 predicted 1064
8 SASI_Rn01_00128590 predicted 1315
9 SASI_Rn01_00128591 predicted 1174
10 SASI_Rn01_00128592 predicted 710
11 SASI_Rn01_00128587 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145676 predicted 273
2 SASI_Mm01_00145677 predicted 688
3 SASI_Mm01_00145678 predicted 1297
4 SASI_Mm01_00145679 predicted 836
5 SASI_Mm01_00145680 predicted 282
6 SASI_Mm01_00145681 predicted 1309
7 SASI_Mm02_00344894 predicted 460
8 SASI_Mm01_00145683 predicted 915
9 SASI_Mm02_00344895 predicted 1188
10 SASI_Mm01_00145684 predicted 710
11 SASI_Mm01_00145682 predicted 509
12 SASI_Mm01_00145685 predicted 1329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198185
OVCH2 MISSION shRNA Bacterial Glycerol Stock
ovochymase 2 (gene/pseudogene)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198185.2-1448s21c1
Sequence:CCGGGAGACTGCACTTCCGACTATGCTCGAGCATAGTCGGAAGTGCAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198185.2-116s21c1
Sequence:CCGGAGGTACAGCCTTGGAATTATTCTCGAGAATAATTCCAAGGCTGTACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1234s1c1
Sequence:CCGGGCTGGGTTTAATCTTACCTATCTCGAGATAGGTAAGATTAAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1187s1c1
Sequence:CCGGCTAATTCTCTAAGGCTGAAATCTCGAGATTTCAGCCTTAGAGAATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-56s1c1
Sequence:CCGGGAGGTAAATCTGCAACTCTTTCTCGAGAAAGAGTTGCAGATTTACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1292s1c1
Sequence:CCGGGCAGTTACTTAACTGTCCTTTCTCGAGAAAGGACAGTTAAGTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1073s1c1
Sequence:CCGGCCCACCTAGATGTTGAGTCTTCTCGAGAAGACTCAACATCTAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198185
OVCH2 MISSION shRNA shRNA Plasmid DNA
ovochymase 2 (gene/pseudogene)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198185.2-1448s21c1
Sequence:CCGGGAGACTGCACTTCCGACTATGCTCGAGCATAGTCGGAAGTGCAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198185.2-116s21c1
Sequence:CCGGAGGTACAGCCTTGGAATTATTCTCGAGAATAATTCCAAGGCTGTACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1234s1c1
Sequence:CCGGGCTGGGTTTAATCTTACCTATCTCGAGATAGGTAAGATTAAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1187s1c1
Sequence:CCGGCTAATTCTCTAAGGCTGAAATCTCGAGATTTCAGCCTTAGAGAATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-56s1c1
Sequence:CCGGGAGGTAAATCTGCAACTCTTTCTCGAGAAAGAGTTGCAGATTTACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1292s1c1
Sequence:CCGGGCAGTTACTTAACTGTCCTTTCTCGAGAAAGGACAGTTAAGTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1073s1c1
Sequence:CCGGCCCACCTAGATGTTGAGTCTTCTCGAGAAGACTCAACATCTAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198185
OVCH2 MISSION shRNA Lentiviral Transduction Particles
ovochymase 2 (gene/pseudogene)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198185.2-1448s21c1
Sequence:CCGGGAGACTGCACTTCCGACTATGCTCGAGCATAGTCGGAAGTGCAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198185.2-116s21c1
Sequence:CCGGAGGTACAGCCTTGGAATTATTCTCGAGAATAATTCCAAGGCTGTACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1234s1c1
Sequence:CCGGGCTGGGTTTAATCTTACCTATCTCGAGATAGGTAAGATTAAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1187s1c1
Sequence:CCGGCTAATTCTCTAAGGCTGAAATCTCGAGATTTCAGCCTTAGAGAATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-56s1c1
Sequence:CCGGGAGGTAAATCTGCAACTCTTTCTCGAGAAAGAGTTGCAGATTTACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1292s1c1
Sequence:CCGGGCAGTTACTTAACTGTCCTTTCTCGAGAAAGGACAGTTAAGTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198185.1-1073s1c1
Sequence:CCGGCCCACCTAGATGTTGAGTCTTCTCGAGAAGACTCAACATCTAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172908
OVCH2 MISSION shRNA Bacterial Glycerol Stock
ovochymase 2 (gene/pseudogene)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-1224s21c1
Sequence:CCGGAGATTATGCCACTGGGTTTAACTCGAGTTAAACCCAGTGGCATAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-504s21c1
Sequence:CCGGACACTTTAATGCTGGATTTATCTCGAGATAAATCCAGCATTAAAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-843s21c1
Sequence:CCGGTGGAATCTTCACAGATCTTAGCTCGAGCTAAGATCTGTGAAGATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-1505s21c1
Sequence:CCGGTAGCTCGGTTCTGCGACTATGCTCGAGCATAGTCGCAGAACCGAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-283s1c1
Sequence:CCGGGCTAACAGAAACATTGCATTACTCGAGTAATGCAATGTTTCTGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-627s1c1
Sequence:CCGGCGTTCTGTTGACCTTAAAGAACTCGAGTTCTTTAAGGTCAACAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-1293s1c1
Sequence:CCGGCAGGTCTCTAACTATCCTCTTCTCGAGAAGAGGATAGTTAGAGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-993s1c1
Sequence:CCGGCCACCTGTACTATGAGAGCAACTCGAGTTGCTCTCATAGTACAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-124s1c1
Sequence:CCGGCCTCAGAATTACTTTAGCCTTCTCGAGAAGGCTAAAGTAATTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172908
OVCH2 MISSION shRNA shRNA Plasmid DNA
ovochymase 2 (gene/pseudogene)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-1224s21c1
Sequence:CCGGAGATTATGCCACTGGGTTTAACTCGAGTTAAACCCAGTGGCATAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-504s21c1
Sequence:CCGGACACTTTAATGCTGGATTTATCTCGAGATAAATCCAGCATTAAAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-843s21c1
Sequence:CCGGTGGAATCTTCACAGATCTTAGCTCGAGCTAAGATCTGTGAAGATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-1505s21c1
Sequence:CCGGTAGCTCGGTTCTGCGACTATGCTCGAGCATAGTCGCAGAACCGAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-283s1c1
Sequence:CCGGGCTAACAGAAACATTGCATTACTCGAGTAATGCAATGTTTCTGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-627s1c1
Sequence:CCGGCGTTCTGTTGACCTTAAAGAACTCGAGTTCTTTAAGGTCAACAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-1293s1c1
Sequence:CCGGCAGGTCTCTAACTATCCTCTTCTCGAGAAGAGGATAGTTAGAGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-993s1c1
Sequence:CCGGCCACCTGTACTATGAGAGCAACTCGAGTTGCTCTCATAGTACAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-124s1c1
Sequence:CCGGCCTCAGAATTACTTTAGCCTTCTCGAGAAGGCTAAAGTAATTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172908
OVCH2 MISSION shRNA Lentiviral Transduction Particles
ovochymase 2 (gene/pseudogene)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-1224s21c1
Sequence:CCGGAGATTATGCCACTGGGTTTAACTCGAGTTAAACCCAGTGGCATAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-504s21c1
Sequence:CCGGACACTTTAATGCTGGATTTATCTCGAGATAAATCCAGCATTAAAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-843s21c1
Sequence:CCGGTGGAATCTTCACAGATCTTAGCTCGAGCTAAGATCTGTGAAGATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172908.3-1505s21c1
Sequence:CCGGTAGCTCGGTTCTGCGACTATGCTCGAGCATAGTCGCAGAACCGAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-283s1c1
Sequence:CCGGGCTAACAGAAACATTGCATTACTCGAGTAATGCAATGTTTCTGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-627s1c1
Sequence:CCGGCGTTCTGTTGACCTTAAAGAACTCGAGTTCTTTAAGGTCAACAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-1293s1c1
Sequence:CCGGCAGGTCTCTAACTATCCTCTTCTCGAGAAGAGGATAGTTAGAGACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-993s1c1
Sequence:CCGGCCACCTGTACTATGAGAGCAACTCGAGTTGCTCTCATAGTACAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172908.2-124s1c1
Sequence:CCGGCCTCAGAATTACTTTAGCCTTCTCGAGAAGGCTAAAGTAATTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)