EMAIL THIS PAGE TO A FRIEND

OVGP1

oviductal glycoprotein 1, 120kDa

41 Gene Product Result for
Synonyms: CHIT5 EGP MUC9 OGP
UniProtKB ID: Q12889, A0AV19, B9EGE1, Q15841
Gene ID:
Human(5016) Summary: This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]
Mouse(12659) oviductal glycoprotein 1
cow(281962) oviductal glycoprotein 1, 120kDa
domestic cat(101094196) oviductal glycoprotein 1, 120kDa
dog(609807) oviductal glycoprotein 1, 120kDa
sheep(443344) oviductal glycoprotein 1, 120kDa
Domestic Rabbit(100008811) oviductal glycoprotein 1, 120kDa
naked mole-rat(101713967) oviductal glycoprotein 1, 120kDa
domestic guinea pig(100724894) oviductal glycoprotein 1, 120kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002557 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037461 MISSION® esiRNA esiRNA human OVGP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002557 Rosetta Predictions human pricing
NM_007696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214468 predicted 766
2 SASI_Hs01_00214469 predicted 1207
3 SASI_Hs01_00214470 predicted 283
4 SASI_Hs01_00214471 predicted 382
5 SASI_Hs01_00214472 predicted 1946
6 SASI_Hs01_00214473 predicted 1988
7 SASI_Hs01_00214474 predicted 973
8 SASI_Hs02_00334047 predicted 759
9 SASI_Hs01_00214475 predicted 987
10 SASI_Hs01_00214477 predicted 912
11 SASI_Hs01_00214476 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028721 predicted 1260
2 SASI_Mm01_00028722 predicted 1016
3 SASI_Mm01_00028723 predicted 710
4 SASI_Mm01_00028724 predicted 377
5 SASI_Mm01_00028725 predicted 1011
6 SASI_Mm01_00028726 predicted 316
7 SASI_Mm02_00312239 predicted 1019
8 SASI_Mm01_00028727 predicted 344
9 SASI_Mm01_00028728 predicted 906
10 SASI_Mm01_00028729 predicted 949
11 SASI_Mm01_00028730 predicted 1016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002557
OVGP1 MISSION shRNA Bacterial Glycerol Stock
oviductal glycoprotein 1, 120kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-1412s21c1
Sequence:CCGGCCCTACAAAGGAAACTGTATCCTCGAGGATACAGTTTCCTTTGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-1178s21c1
Sequence:CCGGTGTCTACGTATTGAATGATATCTCGAGATATCATTCAATACGTAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-627s21c1
Sequence:CCGGATCGTCCAAACATCCTATGATCTCGAGATCATAGGATGTTTGGACGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-1068s21c1
Sequence:CCGGAGTTACAAGGCATGGTTTATACTCGAGTATAAACCATGCCTTGTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-118s1c1
Sequence:CCGGGCCCATAAACTCGTGTGTTATCTCGAGATAACACACGAGTTTATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-669s1c1
Sequence:CCGGCCTGGATTTCATCAATGTCTTCTCGAGAAGACATTGATGAAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-1949s1c1
Sequence:CCGGCGGAACAAACTCCTCTAGCTTCTCGAGAAGCTAGAGGAGTTTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-990s1c1
Sequence:CCGGGCACTGGATTGATTACCAGTACTCGAGTACTGGTAATCAATCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-365s1c1
Sequence:CCGGGCACCTCAAGATTCACCACTACTCGAGTAGTGGTGAATCTTGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002557
OVGP1 MISSION shRNA shRNA Plasmid DNA
oviductal glycoprotein 1, 120kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-1412s21c1
Sequence:CCGGCCCTACAAAGGAAACTGTATCCTCGAGGATACAGTTTCCTTTGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-1178s21c1
Sequence:CCGGTGTCTACGTATTGAATGATATCTCGAGATATCATTCAATACGTAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-627s21c1
Sequence:CCGGATCGTCCAAACATCCTATGATCTCGAGATCATAGGATGTTTGGACGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-1068s21c1
Sequence:CCGGAGTTACAAGGCATGGTTTATACTCGAGTATAAACCATGCCTTGTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-118s1c1
Sequence:CCGGGCCCATAAACTCGTGTGTTATCTCGAGATAACACACGAGTTTATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-669s1c1
Sequence:CCGGCCTGGATTTCATCAATGTCTTCTCGAGAAGACATTGATGAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-1949s1c1
Sequence:CCGGCGGAACAAACTCCTCTAGCTTCTCGAGAAGCTAGAGGAGTTTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-990s1c1
Sequence:CCGGGCACTGGATTGATTACCAGTACTCGAGTACTGGTAATCAATCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-365s1c1
Sequence:CCGGGCACCTCAAGATTCACCACTACTCGAGTAGTGGTGAATCTTGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002557
OVGP1 MISSION shRNA Lentiviral Transduction Particles
oviductal glycoprotein 1, 120kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-1412s21c1
Sequence:CCGGCCCTACAAAGGAAACTGTATCCTCGAGGATACAGTTTCCTTTGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-1178s21c1
Sequence:CCGGTGTCTACGTATTGAATGATATCTCGAGATATCATTCAATACGTAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-627s21c1
Sequence:CCGGATCGTCCAAACATCCTATGATCTCGAGATCATAGGATGTTTGGACGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002557.3-1068s21c1
Sequence:CCGGAGTTACAAGGCATGGTTTATACTCGAGTATAAACCATGCCTTGTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-118s1c1
Sequence:CCGGGCCCATAAACTCGTGTGTTATCTCGAGATAACACACGAGTTTATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-669s1c1
Sequence:CCGGCCTGGATTTCATCAATGTCTTCTCGAGAAGACATTGATGAAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-1949s1c1
Sequence:CCGGCGGAACAAACTCCTCTAGCTTCTCGAGAAGCTAGAGGAGTTTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-990s1c1
Sequence:CCGGGCACTGGATTGATTACCAGTACTCGAGTACTGGTAATCAATCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002557.2-365s1c1
Sequence:CCGGGCACCTCAAGATTCACCACTACTCGAGTAGTGGTGAATCTTGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007696
VALIDATED
OVGP1 MISSION shRNA Bacterial Glycerol Stock
oviductal glycoprotein 1, 120kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-1263s21c1
Sequence:CCGGTTGACCACTGATACCATAAAGCTCGAGCTTTATGGTATCAGTGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-759s21c1
Sequence:CCGGCTTGGGACACCCGCAGATAAACTCGAGTTTATCTGCGGGTGTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-1984s21c1
Sequence:CCGGCGGAGATGGATACGACTCTTTCTCGAGAAAGAGTCGTATCCATCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007696.2-1984s1c1
Sequence:CCGGCGGAGATGGATACGACTCTTTCTCGAGAAAGAGTCGTATCCATCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-582s21c1
Sequence:CCGGAGCATCATCCATACGTCTTATCTCGAGATAAGACGTATGGATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007696.2-76s1c1
Sequence:CCGGCCTACAAACTGGTGTGCTATTCTCGAGAATAGCACACCAGTTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007696.2-2277s21c1
Sequence:CCGGTCAATTGCCCTTCTAACAAATCTCGAGATTTGTTAGAAGGGCAATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007696.2-2194s1c1
Sequence:CCGGGCTCTATTGTCTTGTTCCTATCTCGAGATAGGAACAAGACAATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007696.2-795s1c1
Sequence:CCGGCCCACCTATGGACGTAACTTTCTCGAGAAAGTTACGTCCATAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007696
VALIDATED
OVGP1 MISSION shRNA shRNA Plasmid DNA
oviductal glycoprotein 1, 120kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-1263s21c1
Sequence:CCGGTTGACCACTGATACCATAAAGCTCGAGCTTTATGGTATCAGTGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-759s21c1
Sequence:CCGGCTTGGGACACCCGCAGATAAACTCGAGTTTATCTGCGGGTGTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-1984s21c1
Sequence:CCGGCGGAGATGGATACGACTCTTTCTCGAGAAAGAGTCGTATCCATCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007696.2-1984s1c1
Sequence:CCGGCGGAGATGGATACGACTCTTTCTCGAGAAAGAGTCGTATCCATCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-582s21c1
Sequence:CCGGAGCATCATCCATACGTCTTATCTCGAGATAAGACGTATGGATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007696.2-76s1c1
Sequence:CCGGCCTACAAACTGGTGTGCTATTCTCGAGAATAGCACACCAGTTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007696.2-2277s21c1
Sequence:CCGGTCAATTGCCCTTCTAACAAATCTCGAGATTTGTTAGAAGGGCAATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007696.2-2194s1c1
Sequence:CCGGGCTCTATTGTCTTGTTCCTATCTCGAGATAGGAACAAGACAATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007696.2-795s1c1
Sequence:CCGGCCCACCTATGGACGTAACTTTCTCGAGAAAGTTACGTCCATAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007696
VALIDATED
OVGP1 MISSION shRNA Lentiviral Transduction Particles
oviductal glycoprotein 1, 120kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-1263s21c1
Sequence:CCGGTTGACCACTGATACCATAAAGCTCGAGCTTTATGGTATCAGTGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-759s21c1
Sequence:CCGGCTTGGGACACCCGCAGATAAACTCGAGTTTATCTGCGGGTGTCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-1984s21c1
Sequence:CCGGCGGAGATGGATACGACTCTTTCTCGAGAAAGAGTCGTATCCATCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007696.2-1984s1c1
Sequence:CCGGCGGAGATGGATACGACTCTTTCTCGAGAAAGAGTCGTATCCATCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007696.2-582s21c1
Sequence:CCGGAGCATCATCCATACGTCTTATCTCGAGATAAGACGTATGGATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007696.2-76s1c1
Sequence:CCGGCCTACAAACTGGTGTGCTATTCTCGAGAATAGCACACCAGTTTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007696.2-2277s21c1
Sequence:CCGGTCAATTGCCCTTCTAACAAATCTCGAGATTTGTTAGAAGGGCAATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007696.2-2194s1c1
Sequence:CCGGGCTCTATTGTCTTGTTCCTATCTCGAGATAGGAACAAGACAATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007696.2-795s1c1
Sequence:CCGGCCCACCTATGGACGTAACTTTCTCGAGAAAGTTACGTCCATAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)