EMAIL THIS PAGE TO A FRIEND

OVOL3

ovo-like 3 (Drosophila)

75 Gene Product Result for
UniProtKB ID: O00110
Gene ID:
Mouse(381867) OVO homolog-like 3 (Drosophila)
Rat(365226) ovo-like 3 (Drosophila)
cow(101904292) ovo-like 3 (Drosophila)
domestic cat(101096524) ovo-like 3 (Drosophila)
sheep(101107812) ovo-like 3 (Drosophila)
domestic guinea pig(101789339) ovo-like 3 (Drosophila)
naked mole-rat(101713283) ovo-like 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001479167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001479167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001479167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715091 Rosetta Predictions human pricing
XM_001716321 Rosetta Predictions human pricing
XM_001717165 Rosetta Predictions human pricing
XM_001078974 Rosetta Predictions rat pricing
XM_344878 Rosetta Predictions rat pricing
XM_001479167 Rosetta Predictions mouse pricing
XM_355880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401432 predicted 529
2 SASI_Hs02_00401433 predicted 444
3 SASI_Hs02_00401434 predicted 346
4 SASI_Hs02_00401435 predicted 497
5 SASI_Hs02_00401436 predicted 418
6 SASI_Hs02_00401437 predicted 539
7 SASI_Hs02_00401438 predicted 406
8 SASI_Hs02_00401439 predicted 347
9 SASI_Hs02_00401440 predicted 222
10 SASI_Hs02_00401441 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00409755 predicted 441
2 SASI_Hs02_00409756 predicted 240
3 SASI_Hs02_00409757 predicted 458
4 SASI_Hs02_00409758 predicted 373
5 SASI_Hs02_00409759 predicted 273
6 SASI_Hs02_00409760 predicted 421
7 SASI_Hs02_00409761 predicted 345
8 SASI_Hs02_00409762 predicted 460
9 SASI_Hs02_00409763 predicted 337
10 SASI_Hs02_00409764 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415419 predicted 527
2 SASI_Hs02_00415420 predicted 451
3 SASI_Hs02_00415421 predicted 348
4 SASI_Hs02_00415422 predicted 493
5 SASI_Hs02_00415423 predicted 418
6 SASI_Hs02_00415424 predicted 538
7 SASI_Hs02_00415425 predicted 406
8 SASI_Hs02_00415426 predicted 348
9 SASI_Hs02_00415427 predicted 224
10 SASI_Hs02_00415428 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362692 predicted 279
2 SASI_Rn02_00362693 predicted 251
3 SASI_Rn02_00362694 predicted 334
4 SASI_Rn02_00362695 predicted 284
5 SASI_Rn02_00362696 predicted 221
6 SASI_Rn02_00362697 predicted 317
7 SASI_Rn02_00362698 predicted 278
8 SASI_Rn02_00362699 predicted 290
9 SASI_Rn02_00362700 predicted 280
10 SASI_Rn02_00362701 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397716 predicted 268
2 SASI_Rn02_00397717 predicted 230
3 SASI_Rn02_00397718 predicted 318
4 SASI_Rn02_00397719 predicted 270
5 SASI_Rn02_00397720 predicted 210
6 SASI_Rn02_00397721 predicted 304
7 SASI_Rn02_00397722 predicted 270
8 SASI_Rn02_00397723 predicted 279
9 SASI_Rn02_00397724 predicted 261
10 SASI_Rn02_00397725 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00408091 predicted 232
2 SASI_Mm02_00408092 predicted 257
3 SASI_Mm02_00408093 predicted 201
4 SASI_Mm02_00408094 predicted 304
5 SASI_Mm02_00408095 predicted 266
6 SASI_Mm02_00408096 predicted 270
7 SASI_Mm02_00408097 predicted 275
8 SASI_Mm02_00408098 predicted 280
9 SASI_Mm02_00408099 predicted 287
10 SASI_Mm02_00408100 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425864 predicted 504
2 SASI_Mm02_00425865 predicted 238
3 SASI_Mm01_00223025 predicted 482
4 SASI_Mm01_00223026 predicted 458
5 SASI_Mm01_00223027 predicted 453
6 SASI_Mm01_00223028 predicted 460
7 SASI_Mm01_00223029 predicted 472
8 SASI_Mm02_00425866 predicted 462
9 SASI_Mm02_00425867 predicted 474
10 SASI_Mm02_00425868 predicted 280
11 SASI_Mm01_00223022 predicted 235
12 SASI_Mm01_00223023 predicted 265
13 SASI_Mm01_00223024 predicted 210
14 SASI_Mm01_00223030 predicted 270
15 SASI_Mm01_00223031 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001479167
OVOL3 MISSION shRNA Bacterial Glycerol Stock
ovo-like 3 (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000238888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-334s21c1
Sequence:CCGGCACACTGGAATACGGCCATTCCTCGAGGAATGGCCGTATTCCAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-271s21c1
Sequence:CCGGGTGTGCCACTATTGTGGTAAACTCGAGTTTACCACAATAGTGGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-50s21c1
Sequence:CCGGTCACCATCTGGCTTCTCTTCTCTCGAGAGAAGAGAAGCCAGATGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-297s21c1
Sequence:CCGGTCACGATGCCTTCGATCTCAACTCGAGTTGAGATCGAAGGCATCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001479167
OVOL3 MISSION shRNA shRNA Plasmid DNA
ovo-like 3 (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000238888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-334s21c1
Sequence:CCGGCACACTGGAATACGGCCATTCCTCGAGGAATGGCCGTATTCCAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-271s21c1
Sequence:CCGGGTGTGCCACTATTGTGGTAAACTCGAGTTTACCACAATAGTGGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-50s21c1
Sequence:CCGGTCACCATCTGGCTTCTCTTCTCTCGAGAGAAGAGAAGCCAGATGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-297s21c1
Sequence:CCGGTCACGATGCCTTCGATCTCAACTCGAGTTGAGATCGAAGGCATCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001479167
OVOL3 MISSION shRNA Lentiviral Transduction Particles
ovo-like 3 (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000238888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-334s21c1
Sequence:CCGGCACACTGGAATACGGCCATTCCTCGAGGAATGGCCGTATTCCAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-271s21c1
Sequence:CCGGGTGTGCCACTATTGTGGTAAACTCGAGTTTACCACAATAGTGGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-50s21c1
Sequence:CCGGTCACCATCTGGCTTCTCTTCTCTCGAGAGAAGAGAAGCCAGATGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479167.1-297s21c1
Sequence:CCGGTCACGATGCCTTCGATCTCAACTCGAGTTGAGATCGAAGGCATCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)