EMAIL THIS PAGE TO A FRIEND

OXA1L

oxidase (cytochrome c) assembly 1-like

101 Gene Product Result for
Synonyms: OXA1
UniProtKB ID: Q15070, B4DPA2
Gene ID:
Mouse(69089) oxidase assembly 1-like
Rat(691393) oxidase (cytochrome c) assembly 1-like
Thale Cress(819256) inner membrane OXA1-like protein
dog(480239) oxidase (cytochrome c) assembly 1-like
cow(520335) oxidase (cytochrome c) assembly 1-like
Zebrafish(562963) oxidase (cytochrome c) assembly 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005015 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005015 Rosetta Predictions human pricing
XM_001078039 Rosetta Predictions rat pricing
NM_026936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032039 predicted 364
2 SASI_Hs01_00032040 predicted 1181
3 SASI_Hs01_00032041 predicted 471
4 SASI_Hs01_00032042 predicted 1115
5 SASI_Hs01_00032043 predicted 992
6 SASI_Hs01_00032044 predicted 1162
7 SASI_Hs01_00032045 predicted 952
8 SASI_Hs01_00032046 predicted 1234
9 SASI_Hs01_00032047 predicted 498
10 SASI_Hs01_00032048 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359459 predicted 575
2 SASI_Rn02_00359460 predicted 414
3 SASI_Rn02_00359461 predicted 530
4 SASI_Rn02_00359462 predicted 1301
5 SASI_Rn02_00359463 predicted 265
6 SASI_Rn02_00359464 predicted 629
7 SASI_Rn02_00359465 predicted 889
8 SASI_Rn02_00359466 predicted 928
9 SASI_Rn02_00359467 predicted 1320
10 SASI_Rn02_00359468 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039475 predicted 1392
2 SASI_Mm02_00331230 predicted 591
3 SASI_Mm01_00039476 predicted 780
4 SASI_Mm01_00039477 predicted 1260
5 SASI_Mm01_00039478 predicted 854
6 SASI_Mm01_00039479 predicted 862
7 SASI_Mm01_00039480 predicted 1041
8 SASI_Mm01_00039481 predicted 1054
9 SASI_Mm01_00039482 predicted 998
10 SASI_Mm01_00039483 predicted 979
11 SASI_Mm01_00039484 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026936
OXA1L MISSION shRNA Bacterial Glycerol Stock
oxidase (cytochrome c) assembly 1-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000317768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-672s21c1
Sequence:CCGGCCCGTCTTCATCTCCTTCTTTCTCGAGAAAGAAGGAGATGAAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-238s21c1
Sequence:CCGGCTGTTATTCCTGCTACCTCTACTCGAGTAGAGGTAGCAGGAATAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-878s21c1
Sequence:CCGGGAGGAACATTATCAGGGTGATCTCGAGATCACCCTGATAATGTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-374s21c1
Sequence:CCGGCCAGAACCTCTTGGAATATATCTCGAGATATATTCCAAGAGGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026936
OXA1L MISSION shRNA shRNA Plasmid DNA
oxidase (cytochrome c) assembly 1-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000317768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-672s21c1
Sequence:CCGGCCCGTCTTCATCTCCTTCTTTCTCGAGAAAGAAGGAGATGAAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-238s21c1
Sequence:CCGGCTGTTATTCCTGCTACCTCTACTCGAGTAGAGGTAGCAGGAATAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-878s21c1
Sequence:CCGGGAGGAACATTATCAGGGTGATCTCGAGATCACCCTGATAATGTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-374s21c1
Sequence:CCGGCCAGAACCTCTTGGAATATATCTCGAGATATATTCCAAGAGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026936
OXA1L MISSION shRNA Lentiviral Transduction Particles
oxidase (cytochrome c) assembly 1-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000317768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-672s21c1
Sequence:CCGGCCCGTCTTCATCTCCTTCTTTCTCGAGAAAGAAGGAGATGAAGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-238s21c1
Sequence:CCGGCTGTTATTCCTGCTACCTCTACTCGAGTAGAGGTAGCAGGAATAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-878s21c1
Sequence:CCGGGAGGAACATTATCAGGGTGATCTCGAGATCACCCTGATAATGTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026936.3-374s21c1
Sequence:CCGGCCAGAACCTCTTGGAATATATCTCGAGATATATTCCAAGAGGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005015
VALIDATED
OXA1L MISSION shRNA Bacterial Glycerol Stock
oxidase (cytochrome c) assembly 1-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-1441s21c1
Sequence:CCGGAGCAGCAAACCAAAGTCAAAGCTCGAGCTTTGACTTTGGTTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-745s21c1
Sequence:CCGGGCAGGAGACCATATTGAGTATCTCGAGATACTCAATATGGTCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-724s21c1
Sequence:CCGGCGAATCAGAGAGGCCAAGTTACTCGAGTAACTTGGCCTCTCTGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-1226s21c1
Sequence:CCGGTACATGACCTGGACAAATTACCTCGAGGTAATTTGTCCAGGTCATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-544s21c1
Sequence:CCGGGTGGGACTGATCCAGAATTTACTCGAGTAAATTCTGGATCAGTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005015.1-69s1c1
Sequence:CCGGGCCTGATCTACGGCTACAATTCTCGAGAATTGTAGCCGTAGATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-1056s1c1
Sequence:CCGGGATGAGAAATGTCATCAGAATCTCGAGATTCTGATGACATTTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-724s1c1
Sequence:CCGGCGAATCAGAGAGGCCAAGTTACTCGAGTAACTTGGCCTCTCTGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-544s1c1
Sequence:CCGGGTGGGACTGATCCAGAATTTACTCGAGTAAATTCTGGATCAGTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-745s1c1
Sequence:CCGGGCAGGAGACCATATTGAGTATCTCGAGATACTCAATATGGTCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005015
VALIDATED
OXA1L MISSION shRNA shRNA Plasmid DNA
oxidase (cytochrome c) assembly 1-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-1441s21c1
Sequence:CCGGAGCAGCAAACCAAAGTCAAAGCTCGAGCTTTGACTTTGGTTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-745s21c1
Sequence:CCGGGCAGGAGACCATATTGAGTATCTCGAGATACTCAATATGGTCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-724s21c1
Sequence:CCGGCGAATCAGAGAGGCCAAGTTACTCGAGTAACTTGGCCTCTCTGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-1226s21c1
Sequence:CCGGTACATGACCTGGACAAATTACCTCGAGGTAATTTGTCCAGGTCATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-544s21c1
Sequence:CCGGGTGGGACTGATCCAGAATTTACTCGAGTAAATTCTGGATCAGTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005015.1-69s1c1
Sequence:CCGGGCCTGATCTACGGCTACAATTCTCGAGAATTGTAGCCGTAGATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-1056s1c1
Sequence:CCGGGATGAGAAATGTCATCAGAATCTCGAGATTCTGATGACATTTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-724s1c1
Sequence:CCGGCGAATCAGAGAGGCCAAGTTACTCGAGTAACTTGGCCTCTCTGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-544s1c1
Sequence:CCGGGTGGGACTGATCCAGAATTTACTCGAGTAAATTCTGGATCAGTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-745s1c1
Sequence:CCGGGCAGGAGACCATATTGAGTATCTCGAGATACTCAATATGGTCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005015
VALIDATED
OXA1L MISSION shRNA Lentiviral Transduction Particles
oxidase (cytochrome c) assembly 1-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-1441s21c1
Sequence:CCGGAGCAGCAAACCAAAGTCAAAGCTCGAGCTTTGACTTTGGTTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-745s21c1
Sequence:CCGGGCAGGAGACCATATTGAGTATCTCGAGATACTCAATATGGTCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-724s21c1
Sequence:CCGGCGAATCAGAGAGGCCAAGTTACTCGAGTAACTTGGCCTCTCTGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-1226s21c1
Sequence:CCGGTACATGACCTGGACAAATTACCTCGAGGTAATTTGTCCAGGTCATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005015.3-544s21c1
Sequence:CCGGGTGGGACTGATCCAGAATTTACTCGAGTAAATTCTGGATCAGTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005015.1-69s1c1
Sequence:CCGGGCCTGATCTACGGCTACAATTCTCGAGAATTGTAGCCGTAGATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-1056s1c1
Sequence:CCGGGATGAGAAATGTCATCAGAATCTCGAGATTCTGATGACATTTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-724s1c1
Sequence:CCGGCGAATCAGAGAGGCCAAGTTACTCGAGTAACTTGGCCTCTCTGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-544s1c1
Sequence:CCGGGTGGGACTGATCCAGAATTTACTCGAGTAAATTCTGGATCAGTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005015.1-745s1c1
Sequence:CCGGGCAGGAGACCATATTGAGTATCTCGAGATACTCAATATGGTCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127742
VALIDATED
OXA1L MISSION shRNA Bacterial Glycerol Stock
oxidase (cytochrome c) assembly 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127742.4-235s1c1
Sequence:CCGGCTGTTATTCCTGCTACCTCTACTCGAGTAGAGGTAGCAGGAATAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127742.4-1038s1c1
Sequence:CCGGGTCGTACATGACCCTGACAAACTCGAGTTTGTCAGGGTCATGTACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127742.4-371s1c1
Sequence:CCGGCCAGAACCTCTTGGAATATATCTCGAGATATATTCCAAGAGGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127742.4-875s1c1
Sequence:CCGGGAGGAACATTATCAGGGTGATCTCGAGATCACCCTGATAATGTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127742.4-669s1c1
Sequence:CCGGCCCGTCTTCATCTCCTTCTTTCTCGAGAAAGAAGGAGATGAAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127742
VALIDATED
OXA1L MISSION shRNA shRNA Plasmid DNA
oxidase (cytochrome c) assembly 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127742.4-235s1c1
Sequence:CCGGCTGTTATTCCTGCTACCTCTACTCGAGTAGAGGTAGCAGGAATAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127742.4-1038s1c1
Sequence:CCGGGTCGTACATGACCCTGACAAACTCGAGTTTGTCAGGGTCATGTACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127742.4-371s1c1
Sequence:CCGGCCAGAACCTCTTGGAATATATCTCGAGATATATTCCAAGAGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127742.4-875s1c1
Sequence:CCGGGAGGAACATTATCAGGGTGATCTCGAGATCACCCTGATAATGTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127742.4-669s1c1
Sequence:CCGGCCCGTCTTCATCTCCTTCTTTCTCGAGAAAGAAGGAGATGAAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127742
VALIDATED
OXA1L MISSION shRNA Lentiviral Transduction Particles
oxidase (cytochrome c) assembly 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127742.4-235s1c1
Sequence:CCGGCTGTTATTCCTGCTACCTCTACTCGAGTAGAGGTAGCAGGAATAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127742.4-1038s1c1
Sequence:CCGGGTCGTACATGACCCTGACAAACTCGAGTTTGTCAGGGTCATGTACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127742.4-371s1c1
Sequence:CCGGCCAGAACCTCTTGGAATATATCTCGAGATATATTCCAAGAGGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127742.4-875s1c1
Sequence:CCGGGAGGAACATTATCAGGGTGATCTCGAGATCACCCTGATAATGTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127742.4-669s1c1
Sequence:CCGGCCCGTCTTCATCTCCTTCTTTCTCGAGAAAGAAGGAGATGAAGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)