EMAIL THIS PAGE TO A FRIEND

OXCT1

3-oxoacid CoA transferase 1

87 Gene Product Result for
Synonyms: OXCT SCOT
UniProtKB ID: P55809
Gene ID:
Human(5019) Summary: This gene encodes a member of the 3-oxoacid CoA-transferase gene family. The encoded protein is a homodimeric mitochondrial matrix enzyme that plays a central role in extrahepatic ketone body catabolism by catalyzing the reversible transfer of coenzyme A from succinyl-CoA to acetoacetate. Mutations in this gene are associated with succinyl CoA:3-oxoacid CoA transferase deficiency. [provided by RefSeq, Jul 2008]
Mouse(67041) 3-oxoacid CoA transferase 1
Rat(690163) 3-oxoacid CoA transferase 1
domestic guinea pig(100733415) 3-oxoacid CoA transferase 1
naked mole-rat(101718900) 3-oxoacid CoA transferase 1
Domestic Rabbit(100356813) 3-oxoacid CoA transferase 1
sheep(101102177) 3-oxoacid CoA transferase 1
chicken(427190) 3-oxoacid CoA transferase 1
cow(535804) 3-oxoacid CoA transferase 1
Horse(100065846) 3-oxoacid CoA transferase 1
domestic cat(100151771) 3-oxoacid CoA transferase 1
dog(479347) 3-oxoacid CoA transferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024188 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024188 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024188 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000436 Rosetta Predictions human pricing
NM_001127580 Rosetta Predictions rat pricing
NM_024188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114976 predicted 1117
2 SASI_Hs01_00114977 predicted 1953
3 SASI_Hs01_00114978 predicted 1478
4 SASI_Hs01_00114979 predicted 683
5 SASI_Hs01_00114980 predicted 690
6 SASI_Hs01_00114981 predicted 862
7 SASI_Hs01_00114982 predicted 1882
8 SASI_Hs01_00114983 predicted 1055
9 SASI_Hs01_00114984 predicted 1784
10 SASI_Hs01_00114985 predicted 1877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127580 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254530 predicted 1732
2 SASI_Rn02_00254531 predicted 1719
3 SASI_Rn02_00254532 predicted 1243
4 SASI_Rn02_00254533 predicted 1702
5 SASI_Rn02_00254534 predicted 460
6 SASI_Rn02_00254535 predicted 882
7 SASI_Rn02_00254536 predicted 1603
8 SASI_Rn02_00254537 predicted 919
9 SASI_Rn02_00254538 predicted 378
10 SASI_Rn02_00254539 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163665 predicted 908
2 SASI_Mm01_00163666 predicted 1783
3 SASI_Mm01_00163667 predicted 1324
4 SASI_Mm01_00163668 predicted 1023
5 SASI_Mm01_00163669 predicted 1341
6 SASI_Mm01_00163670 predicted 550
7 SASI_Mm01_00163671 predicted 1854
8 SASI_Mm01_00163672 predicted 627
9 SASI_Mm01_00163673 predicted 697
10 SASI_Mm01_00163674 predicted 1167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000436
VALIDATED
OXCT1 MISSION shRNA Bacterial Glycerol Stock
3-oxoacid CoA transferase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-166s1c1
Sequence:CCGGCCTGGTACAAGGGATGTGTTTCTCGAGAAACACATCCCTTGTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000436.1-404s1c1
Sequence:CCGGGCTTCGGTCGAAGCAGATAAACTCGAGTTTATCTGCTTCGACCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-1240s1c1
Sequence:CCGGCCAGCGATGAATCATTTGCAACTCGAGTTGCAAATGATTCATCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-1312s1c1
Sequence:CCGGCCAAATATGGTGACCTGGCTACTCGAGTAGCCAGGTCACCATATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-1638s1c1
Sequence:CCGGCCAATGCAGCAGATCGCAAATCTCGAGATTTGCGATCTGCTGCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-1871s21c1
Sequence:CCGGCCAATGCAGCAGATCGCAAATCTCGAGATTTGCGATCTGCTGCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-978s21c1
Sequence:CCGGACCGAGCAGGAAACGTGATTTCTCGAGAAATCACGTTTCCTGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-1473s21c1
Sequence:CCGGCCAGCGATGAATCATTTGCAACTCGAGTTGCAAATGATTCATCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-399s21c1
Sequence:CCGGCCTGGTACAAGGGATGTGTTTCTCGAGAAACACATCCCTTGTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000436
VALIDATED
OXCT1 MISSION shRNA shRNA Plasmid DNA
3-oxoacid CoA transferase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-166s1c1
Sequence:CCGGCCTGGTACAAGGGATGTGTTTCTCGAGAAACACATCCCTTGTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000436.1-404s1c1
Sequence:CCGGGCTTCGGTCGAAGCAGATAAACTCGAGTTTATCTGCTTCGACCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-1240s1c1
Sequence:CCGGCCAGCGATGAATCATTTGCAACTCGAGTTGCAAATGATTCATCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-1312s1c1
Sequence:CCGGCCAAATATGGTGACCTGGCTACTCGAGTAGCCAGGTCACCATATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-1638s1c1
Sequence:CCGGCCAATGCAGCAGATCGCAAATCTCGAGATTTGCGATCTGCTGCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-1871s21c1
Sequence:CCGGCCAATGCAGCAGATCGCAAATCTCGAGATTTGCGATCTGCTGCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-978s21c1
Sequence:CCGGACCGAGCAGGAAACGTGATTTCTCGAGAAATCACGTTTCCTGCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-1473s21c1
Sequence:CCGGCCAGCGATGAATCATTTGCAACTCGAGTTGCAAATGATTCATCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-399s21c1
Sequence:CCGGCCTGGTACAAGGGATGTGTTTCTCGAGAAACACATCCCTTGTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000436
VALIDATED
OXCT1 MISSION shRNA Lentiviral Transduction Particles
3-oxoacid CoA transferase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-166s1c1
Sequence:CCGGCCTGGTACAAGGGATGTGTTTCTCGAGAAACACATCCCTTGTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000436.1-404s1c1
Sequence:CCGGGCTTCGGTCGAAGCAGATAAACTCGAGTTTATCTGCTTCGACCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-1240s1c1
Sequence:CCGGCCAGCGATGAATCATTTGCAACTCGAGTTGCAAATGATTCATCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-1312s1c1
Sequence:CCGGCCAAATATGGTGACCTGGCTACTCGAGTAGCCAGGTCACCATATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000436.1-1638s1c1
Sequence:CCGGCCAATGCAGCAGATCGCAAATCTCGAGATTTGCGATCTGCTGCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-1871s21c1
Sequence:CCGGCCAATGCAGCAGATCGCAAATCTCGAGATTTGCGATCTGCTGCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-978s21c1
Sequence:CCGGACCGAGCAGGAAACGTGATTTCTCGAGAAATCACGTTTCCTGCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-1473s21c1
Sequence:CCGGCCAGCGATGAATCATTTGCAACTCGAGTTGCAAATGATTCATCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000436.3-399s21c1
Sequence:CCGGCCTGGTACAAGGGATGTGTTTCTCGAGAAACACATCCCTTGTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024188
OXCT1 MISSION shRNA Bacterial Glycerol Stock
3-oxoacid CoA transferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-826s1c1
Sequence:CCGGCGCCTCATAAAGGGAGAGAAACTCGAGTTTCTCTCCCTTTATGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-250s1c1
Sequence:CCGGGCTTTACTGAAGACTGGAGTACTCGAGTACTCCAGTCTTCAGTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024188.3-1690s1c1
Sequence:CCGGGCAAGAAGTTTCGGCTAGTTTCTCGAGAAACTAGCCGAAACTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-827s1c1
Sequence:CCGGGCCTCATAAAGGGAGAGAAATCTCGAGATTTCTCTCCCTTTATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-1357s1c1
Sequence:CCGGGCGAAGGGAAATGCTCATAAACTCGAGTTTATGAGCATTTCCCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024188.6-2010s21c1
Sequence:CCGGGCAAGAAGTTTCGGCTAGTTTCTCGAGAAACTAGCCGAAACTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024188.6-570s21c1
Sequence:CCGGGCTTTACTGAAGACTGGAGTACTCGAGTACTCCAGTCTTCAGTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024188.6-1147s21c1
Sequence:CCGGGCCTCATAAAGGGAGAGAAATCTCGAGATTTCTCTCCCTTTATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024188.6-1677s21c1
Sequence:CCGGGCGAAGGGAAATGCTCATAAACTCGAGTTTATGAGCATTTCCCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024188
OXCT1 MISSION shRNA shRNA Plasmid DNA
3-oxoacid CoA transferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-826s1c1
Sequence:CCGGCGCCTCATAAAGGGAGAGAAACTCGAGTTTCTCTCCCTTTATGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-250s1c1
Sequence:CCGGGCTTTACTGAAGACTGGAGTACTCGAGTACTCCAGTCTTCAGTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024188.3-1690s1c1
Sequence:CCGGGCAAGAAGTTTCGGCTAGTTTCTCGAGAAACTAGCCGAAACTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-827s1c1
Sequence:CCGGGCCTCATAAAGGGAGAGAAATCTCGAGATTTCTCTCCCTTTATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-1357s1c1
Sequence:CCGGGCGAAGGGAAATGCTCATAAACTCGAGTTTATGAGCATTTCCCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024188.6-2010s21c1
Sequence:CCGGGCAAGAAGTTTCGGCTAGTTTCTCGAGAAACTAGCCGAAACTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024188.6-570s21c1
Sequence:CCGGGCTTTACTGAAGACTGGAGTACTCGAGTACTCCAGTCTTCAGTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024188.6-1147s21c1
Sequence:CCGGGCCTCATAAAGGGAGAGAAATCTCGAGATTTCTCTCCCTTTATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024188.6-1677s21c1
Sequence:CCGGGCGAAGGGAAATGCTCATAAACTCGAGTTTATGAGCATTTCCCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024188
OXCT1 MISSION shRNA Lentiviral Transduction Particles
3-oxoacid CoA transferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-826s1c1
Sequence:CCGGCGCCTCATAAAGGGAGAGAAACTCGAGTTTCTCTCCCTTTATGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-250s1c1
Sequence:CCGGGCTTTACTGAAGACTGGAGTACTCGAGTACTCCAGTCTTCAGTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024188.3-1690s1c1
Sequence:CCGGGCAAGAAGTTTCGGCTAGTTTCTCGAGAAACTAGCCGAAACTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-827s1c1
Sequence:CCGGGCCTCATAAAGGGAGAGAAATCTCGAGATTTCTCTCCCTTTATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024188.3-1357s1c1
Sequence:CCGGGCGAAGGGAAATGCTCATAAACTCGAGTTTATGAGCATTTCCCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024188.6-2010s21c1
Sequence:CCGGGCAAGAAGTTTCGGCTAGTTTCTCGAGAAACTAGCCGAAACTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024188.6-570s21c1
Sequence:CCGGGCTTTACTGAAGACTGGAGTACTCGAGTACTCCAGTCTTCAGTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024188.6-1147s21c1
Sequence:CCGGGCCTCATAAAGGGAGAGAAATCTCGAGATTTCTCTCCCTTTATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024188.6-1677s21c1
Sequence:CCGGGCGAAGGGAAATGCTCATAAACTCGAGTTTATGAGCATTTCCCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)