EMAIL THIS PAGE TO A FRIEND

OXCT2

3-oxoacid CoA transferase 2

21 Gene Product Result for
Synonyms: SCOTT
UniProtKB ID: Q9BYC2, B2RBB4, Q5QPK4, Q8NHR1, Q9H1I4
Gene ID:
Human(64064) Summary: OXCT2 is a testis-specific succinyl-CoA:3-oxoacid CoA transferase (EC 2.8.3.5), which catalyzes the reversible transfer of CoA from succinyl-CoA to acetoacetate in the first step of ketone body utilization. See also OXCT1 (MIM 601424).[supplied by OMIM, Mar 2008]
cow(504655) succinyl-CoA:3-ketoacid coenzyme A transferase 2, mitochondrial-like
cow(782973) 3-oxoacid CoA transferase 2
sheep(101121140) 3-oxoacid CoA transferase 2
naked mole-rat(101716155) 3-oxoacid CoA transferase 2
domestic guinea pig(100718728) 3-oxoacid CoA transferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022120 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117661 MISSION® esiRNA esiRNA human OXCT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022120 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051292 predicted 1325
2 SASI_Hs01_00051295 predicted 1254
3 SASI_Hs01_00051297 predicted 1397
4 SASI_Hs01_00051288 predicted 925
5 SASI_Hs01_00051289 predicted 929
6 SASI_Hs01_00051290 predicted 920
7 SASI_Hs01_00051291 predicted 865
8 SASI_Hs01_00051293 predicted 915
9 SASI_Hs01_00051294 predicted 1090
10 SASI_Hs02_00355515 predicted 757
11 SASI_Hs01_00051296 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022120
OXCT2 MISSION shRNA Bacterial Glycerol Stock
3-oxoacid CoA transferase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-1003s21c1
Sequence:CCGGAGACGCGCAGCTCTGGAATTTCTCGAGAAATTCCAGAGCTGCGCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-1034s21c1
Sequence:CCGGTGTACGCCAATCTGGGCATAGCTCGAGCTATGCCCAGATTGGCGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-921s21c1
Sequence:CCGGGAAACGAATTGAGCGCTTAACCTCGAGGTTAAGCGCTCAATTCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-1400s21c1
Sequence:CCGGTCACCATGCAGCACTGCACAACTCGAGTTGTGCAGTGCTGCATGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022120.1-774s1c1
Sequence:CCGGCCGCAATTTCAACGTGCCCATCTCGAGATGGGCACGTTGAAATTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022120.1-871s1c1
Sequence:CCGGCACGTTCCTAACATTTATGTACTCGAGTACATAAATGTTAGGAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022120.1-1261s1c1
Sequence:CCGGCACATCCAACTAACCATGCTTCTCGAGAAGCATGGTTAGTTGGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022120
OXCT2 MISSION shRNA shRNA Plasmid DNA
3-oxoacid CoA transferase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-1003s21c1
Sequence:CCGGAGACGCGCAGCTCTGGAATTTCTCGAGAAATTCCAGAGCTGCGCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-1034s21c1
Sequence:CCGGTGTACGCCAATCTGGGCATAGCTCGAGCTATGCCCAGATTGGCGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-921s21c1
Sequence:CCGGGAAACGAATTGAGCGCTTAACCTCGAGGTTAAGCGCTCAATTCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-1400s21c1
Sequence:CCGGTCACCATGCAGCACTGCACAACTCGAGTTGTGCAGTGCTGCATGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022120.1-774s1c1
Sequence:CCGGCCGCAATTTCAACGTGCCCATCTCGAGATGGGCACGTTGAAATTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022120.1-871s1c1
Sequence:CCGGCACGTTCCTAACATTTATGTACTCGAGTACATAAATGTTAGGAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022120.1-1261s1c1
Sequence:CCGGCACATCCAACTAACCATGCTTCTCGAGAAGCATGGTTAGTTGGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022120
OXCT2 MISSION shRNA Lentiviral Transduction Particles
3-oxoacid CoA transferase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-1003s21c1
Sequence:CCGGAGACGCGCAGCTCTGGAATTTCTCGAGAAATTCCAGAGCTGCGCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-1034s21c1
Sequence:CCGGTGTACGCCAATCTGGGCATAGCTCGAGCTATGCCCAGATTGGCGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-921s21c1
Sequence:CCGGGAAACGAATTGAGCGCTTAACCTCGAGGTTAAGCGCTCAATTCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022120.1-1400s21c1
Sequence:CCGGTCACCATGCAGCACTGCACAACTCGAGTTGTGCAGTGCTGCATGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022120.1-774s1c1
Sequence:CCGGCCGCAATTTCAACGTGCCCATCTCGAGATGGGCACGTTGAAATTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022120.1-871s1c1
Sequence:CCGGCACGTTCCTAACATTTATGTACTCGAGTACATAAATGTTAGGAACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022120.1-1261s1c1
Sequence:CCGGCACATCCAACTAACCATGCTTCTCGAGAAGCATGGTTAGTTGGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)