EMAIL THIS PAGE TO A FRIEND

OXGR1

oxoglutarate (alpha-ketoglutarate) receptor 1

80 Gene Product Result for
Synonyms: GPR80 GPR99 P2RY15 P2Y15
UniProtKB ID: Q96P68, Q5T5A7, Q86TL1
Gene ID:
Mouse(239283) oxoglutarate (alpha-ketoglutarate) receptor 1
Rat(290493) oxoglutarate (alpha-ketoglutarate) receptor 1
sheep(101109190) oxoglutarate (alpha-ketoglutarate) receptor 1
domestic guinea pig(100725781) oxoglutarate (alpha-ketoglutarate) receptor 1
naked mole-rat(101711547) oxoglutarate (alpha-ketoglutarate) receptor 1
chicken(428023) oxoglutarate (alpha-ketoglutarate) receptor 1
dog(485527) oxoglutarate (alpha-ketoglutarate) receptor 1
cow(539318) oxoglutarate (alpha-ketoglutarate) receptor 1
domestic cat(101096943) oxoglutarate (alpha-ketoglutarate) receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080818 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143971 MISSION® esiRNA esiRNA human OXGR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080818 Rosetta Predictions human pricing
NM_207588 Rosetta Predictions rat pricing
NM_001001490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193518 predicted 1033
2 SASI_Hs01_00193521 predicted 254
3 SASI_Hs01_00193522 predicted 1075
4 SASI_Hs01_00193523 predicted 540
5 SASI_Hs02_00362589 predicted 538
6 SASI_Hs01_00193524 predicted 891
7 SASI_Hs01_00193525 predicted 887
8 SASI_Hs01_00193526 predicted 815
9 SASI_Hs02_00362590 predicted 1031
10 SASI_Hs02_00362591 predicted 868
11 SASI_Hs01_00193517 predicted 1243
12 SASI_Hs01_00193519 predicted 958
13 SASI_Hs01_00193520 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072558 predicted 557
2 SASI_Rn01_00072559 predicted 298
3 SASI_Rn01_00072560 predicted 221
4 SASI_Rn01_00072561 predicted 552
5 SASI_Rn01_00072562 predicted 637
6 SASI_Rn01_00072563 predicted 560
7 SASI_Rn01_00072564 predicted 638
8 SASI_Rn01_00072566 predicted 495
9 SASI_Rn02_00270404 predicted 225
10 SASI_Rn01_00072567 predicted 636
11 SASI_Rn01_00072565 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056146 predicted 1159
2 SASI_Mm01_00056147 predicted 910
3 SASI_Mm01_00056148 predicted 1518
4 SASI_Mm01_00056149 predicted 1315
5 SASI_Mm01_00056150 predicted 1083
6 SASI_Mm01_00056151 predicted 557
7 SASI_Mm01_00056153 predicted 1160
8 SASI_Mm01_00056154 predicted 1250
9 SASI_Mm01_00056155 predicted 1006
10 SASI_Mm02_00286172 predicted 1576
11 SASI_Mm01_00056152 predicted 1372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080818
OXGR1 MISSION shRNA Bacterial Glycerol Stock
oxoglutarate (alpha-ketoglutarate) receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-343s21c1
Sequence:CCGGGCACTACCTCCCTGTTATTTACTCGAGTAAATAACAGGGAGGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-1094s21c1
Sequence:CCGGTACATCGTTTCTAGACCATTACTCGAGTAATGGTCTAGAAACGATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-889s21c1
Sequence:CCGGACTTTGCTATACCACGATTATCTCGAGATAATCGTGGTATAGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-812s21c1
Sequence:CCGGGATGAACTCAATACTATTAAGCTCGAGCTTAATAGTATTGAGTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080818.2-1108s1c1
Sequence:CCGGCCTCAATGGAACTCCTGGTAACTCGAGTTACCAGGAGTTCCATTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-646s1c1
Sequence:CCGGCCTTGGTGATAGTGACACTTTCTCGAGAAAGTGTCACTATCACCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-820s1c1
Sequence:CCGGGCCTGCTTTCAATCAGTTGTTCTCGAGAACAACTGATTGAAAGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-577s1c1
Sequence:CCGGCCAGTTCGGATGAACTCAATACTCGAGTATTGAGTTCATCCGAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-122s1c1
Sequence:CCGGCCTCCCTGTTATTTATGGCATCTCGAGATGCCATAAATAACAGGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080818
OXGR1 MISSION shRNA shRNA Plasmid DNA
oxoglutarate (alpha-ketoglutarate) receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-343s21c1
Sequence:CCGGGCACTACCTCCCTGTTATTTACTCGAGTAAATAACAGGGAGGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-1094s21c1
Sequence:CCGGTACATCGTTTCTAGACCATTACTCGAGTAATGGTCTAGAAACGATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-889s21c1
Sequence:CCGGACTTTGCTATACCACGATTATCTCGAGATAATCGTGGTATAGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-812s21c1
Sequence:CCGGGATGAACTCAATACTATTAAGCTCGAGCTTAATAGTATTGAGTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080818.2-1108s1c1
Sequence:CCGGCCTCAATGGAACTCCTGGTAACTCGAGTTACCAGGAGTTCCATTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-646s1c1
Sequence:CCGGCCTTGGTGATAGTGACACTTTCTCGAGAAAGTGTCACTATCACCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-820s1c1
Sequence:CCGGGCCTGCTTTCAATCAGTTGTTCTCGAGAACAACTGATTGAAAGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-577s1c1
Sequence:CCGGCCAGTTCGGATGAACTCAATACTCGAGTATTGAGTTCATCCGAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-122s1c1
Sequence:CCGGCCTCCCTGTTATTTATGGCATCTCGAGATGCCATAAATAACAGGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080818
OXGR1 MISSION shRNA Lentiviral Transduction Particles
oxoglutarate (alpha-ketoglutarate) receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-343s21c1
Sequence:CCGGGCACTACCTCCCTGTTATTTACTCGAGTAAATAACAGGGAGGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-1094s21c1
Sequence:CCGGTACATCGTTTCTAGACCATTACTCGAGTAATGGTCTAGAAACGATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-889s21c1
Sequence:CCGGACTTTGCTATACCACGATTATCTCGAGATAATCGTGGTATAGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080818.3-812s21c1
Sequence:CCGGGATGAACTCAATACTATTAAGCTCGAGCTTAATAGTATTGAGTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080818.2-1108s1c1
Sequence:CCGGCCTCAATGGAACTCCTGGTAACTCGAGTTACCAGGAGTTCCATTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-646s1c1
Sequence:CCGGCCTTGGTGATAGTGACACTTTCTCGAGAAAGTGTCACTATCACCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-820s1c1
Sequence:CCGGGCCTGCTTTCAATCAGTTGTTCTCGAGAACAACTGATTGAAAGCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-577s1c1
Sequence:CCGGCCAGTTCGGATGAACTCAATACTCGAGTATTGAGTTCATCCGAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080818.2-122s1c1
Sequence:CCGGCCTCCCTGTTATTTATGGCATCTCGAGATGCCATAAATAACAGGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001490
OXGR1 MISSION shRNA Bacterial Glycerol Stock
oxoglutarate (alpha-ketoglutarate) receptor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-624s21c1
Sequence:CCGGAGTACCTTCCCGTCATCTATACTCGAGTATAGATGACGGGAAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-779s21c1
Sequence:CCGGCTCCCGTTCCTCATCCATTACCTCGAGGTAATGGATGAGGAACGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001490.2-3445s21c1
Sequence:CCGGCTACTCGTTAGTATCATATATCTCGAGATATATGATACTAACGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-1168s21c1
Sequence:CCGGACTTTGCTACACGACAATTATCTCGAGATAATTGTCGTGTAGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-1101s21c1
Sequence:CCGGCTACTATCAAGTGGTACAATCCTCGAGGATTGTACCACTTGATAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001490.1-29s1c1
Sequence:CCGGGTGATTCGGATTTCCTGGATTCTCGAGAATCCAGGAAATCCGAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001490.1-847s1c1
Sequence:CCGGGCTTACATTGTTTCTAGACCACTCGAGTGGTCTAGAAACAATGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001490.1-807s1c1
Sequence:CCGGGCTTTCAATCAGCTGCTCCATCTCGAGATGGAGCAGCTGATTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001490
OXGR1 MISSION shRNA shRNA Plasmid DNA
oxoglutarate (alpha-ketoglutarate) receptor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-624s21c1
Sequence:CCGGAGTACCTTCCCGTCATCTATACTCGAGTATAGATGACGGGAAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-779s21c1
Sequence:CCGGCTCCCGTTCCTCATCCATTACCTCGAGGTAATGGATGAGGAACGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001490.2-3445s21c1
Sequence:CCGGCTACTCGTTAGTATCATATATCTCGAGATATATGATACTAACGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-1168s21c1
Sequence:CCGGACTTTGCTACACGACAATTATCTCGAGATAATTGTCGTGTAGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-1101s21c1
Sequence:CCGGCTACTATCAAGTGGTACAATCCTCGAGGATTGTACCACTTGATAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001490.1-29s1c1
Sequence:CCGGGTGATTCGGATTTCCTGGATTCTCGAGAATCCAGGAAATCCGAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001490.1-847s1c1
Sequence:CCGGGCTTACATTGTTTCTAGACCACTCGAGTGGTCTAGAAACAATGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001490.1-807s1c1
Sequence:CCGGGCTTTCAATCAGCTGCTCCATCTCGAGATGGAGCAGCTGATTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001490
OXGR1 MISSION shRNA Lentiviral Transduction Particles
oxoglutarate (alpha-ketoglutarate) receptor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-624s21c1
Sequence:CCGGAGTACCTTCCCGTCATCTATACTCGAGTATAGATGACGGGAAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-779s21c1
Sequence:CCGGCTCCCGTTCCTCATCCATTACCTCGAGGTAATGGATGAGGAACGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001490.2-3445s21c1
Sequence:CCGGCTACTCGTTAGTATCATATATCTCGAGATATATGATACTAACGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-1168s21c1
Sequence:CCGGACTTTGCTACACGACAATTATCTCGAGATAATTGTCGTGTAGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001490.2-1101s21c1
Sequence:CCGGCTACTATCAAGTGGTACAATCCTCGAGGATTGTACCACTTGATAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001490.1-29s1c1
Sequence:CCGGGTGATTCGGATTTCCTGGATTCTCGAGAATCCAGGAAATCCGAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001490.1-847s1c1
Sequence:CCGGGCTTACATTGTTTCTAGACCACTCGAGTGGTCTAGAAACAATGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001490.1-807s1c1
Sequence:CCGGGCTTTCAATCAGCTGCTCCATCTCGAGATGGAGCAGCTGATTGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)