EMAIL THIS PAGE TO A FRIEND

OXNAD1

oxidoreductase NAD-binding domain containing 1

57 Gene Product Result for
UniProtKB ID: Q96HP4, Q2HYC7, Q59FA4
Gene ID:
Mouse(218885) oxidoreductase NAD-binding domain containing 1
Rat(306270) oxidoreductase NAD-binding domain containing 1
sheep(101120461) oxidoreductase NAD-binding domain containing 1
domestic guinea pig(100722869) oxidoreductase NAD-binding domain containing 1
naked mole-rat(101721092) oxidoreductase NAD-binding domain containing 1
Zebrafish(558500) oxidoreductase NAD-binding domain containing 1
chicken(420644) oxidoreductase NAD-binding domain containing 1
domestic cat(101097511) oxidoreductase NAD-binding domain containing 1
cow(510462) oxidoreductase NAD-binding domain containing 1
dog(610514) oxidoreductase NAD-binding domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145460 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145460 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145460 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138381 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138381 Rosetta Predictions human pricing
NM_001107295 Rosetta Predictions rat pricing
NM_145460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363507 predicted 825
2 SASI_Hs01_00037035 predicted 545
3 SASI_Hs01_00037036 predicted 636
4 SASI_Hs02_00363508 predicted 571
5 SASI_Hs01_00037037 predicted 555
6 SASI_Hs01_00037038 predicted 684
7 SASI_Hs01_00037039 predicted 1172
8 SASI_Hs01_00037040 predicted 826
9 SASI_Hs01_00037042 predicted 532
10 SASI_Hs02_00363509 predicted 1210
11 SASI_Hs01_00037034 predicted 1070
12 SASI_Hs01_00037041 predicted 990
13 SASI_Hs01_00037043 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227435 predicted 879
2 SASI_Rn02_00227436 predicted 971
3 SASI_Rn02_00227437 predicted 1212
4 SASI_Rn02_00227438 predicted 578
5 SASI_Rn02_00227439 predicted 394
6 SASI_Rn02_00227440 predicted 424
7 SASI_Rn02_00227441 predicted 700
8 SASI_Rn02_00227442 predicted 810
9 SASI_Rn02_00227443 predicted 902
10 SASI_Rn02_00227444 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128609 predicted 1098
2 SASI_Mm02_00340853 predicted 572
3 SASI_Mm02_00340854 predicted 924
4 SASI_Mm01_00128611 predicted 938
5 SASI_Mm02_00340855 predicted 1081
6 SASI_Mm01_00128612 predicted 1013
7 SASI_Mm02_00340856 predicted 1087
8 SASI_Mm01_00128613 predicted 1000
9 SASI_Mm01_00128614 predicted 1363
10 SASI_Mm02_00340857 predicted 1138
11 SASI_Mm01_00128608 predicted 823
12 SASI_Mm01_00128610 predicted 299
13 SASI_Mm01_00128615 predicted 617
14 SASI_Mm01_00128616 predicted 873
15 SASI_Mm01_00128617 predicted 211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145460
VALIDATED
OXNAD1 MISSION shRNA Bacterial Glycerol Stock
oxidoreductase NAD-binding domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145460.2-1677s21c1
Sequence:CCGGCCACATAAGCAAGTTACAGAACTCGAGTTCTGTAACTTGCTTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145460.2-1038s21c1
Sequence:CCGGCTGAGAAGATTTCTTGCAGTTCTCGAGAACTGCAAGAAATCTTCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145460.2-942s21c1
Sequence:CCGGGCTATGAGATAGGGACAGTAACTCGAGTTACTGTCCCTATCTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145460.2-1521s21c1
Sequence:CCGGGCCACATTTCAGATTGCCATACTCGAGTATGGCAATCTGAAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145460.1-1297s1c1
Sequence:CCGGGCCACATTTCAGATTGCCATACTCGAGTATGGCAATCTGAAATGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145460.1-720s1c1
Sequence:CCGGGCTATGAGATAGGGACAGTAACTCGAGTTACTGTCCCTATCTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145460.1-816s1c1
Sequence:CCGGCTGAGAAGATTTCTTGCAGTTCTCGAGAACTGCAAGAAATCTTCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145460.1-1453s1c1
Sequence:CCGGCCACATAAGCAAGTTACAGAACTCGAGTTCTGTAACTTGCTTATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145460
VALIDATED
OXNAD1 MISSION shRNA shRNA Plasmid DNA
oxidoreductase NAD-binding domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145460.2-1677s21c1
Sequence:CCGGCCACATAAGCAAGTTACAGAACTCGAGTTCTGTAACTTGCTTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145460.2-1038s21c1
Sequence:CCGGCTGAGAAGATTTCTTGCAGTTCTCGAGAACTGCAAGAAATCTTCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145460.2-942s21c1
Sequence:CCGGGCTATGAGATAGGGACAGTAACTCGAGTTACTGTCCCTATCTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145460.2-1521s21c1
Sequence:CCGGGCCACATTTCAGATTGCCATACTCGAGTATGGCAATCTGAAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145460.1-1297s1c1
Sequence:CCGGGCCACATTTCAGATTGCCATACTCGAGTATGGCAATCTGAAATGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145460.1-720s1c1
Sequence:CCGGGCTATGAGATAGGGACAGTAACTCGAGTTACTGTCCCTATCTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145460.1-816s1c1
Sequence:CCGGCTGAGAAGATTTCTTGCAGTTCTCGAGAACTGCAAGAAATCTTCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145460.1-1453s1c1
Sequence:CCGGCCACATAAGCAAGTTACAGAACTCGAGTTCTGTAACTTGCTTATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145460
VALIDATED
OXNAD1 MISSION shRNA Lentiviral Transduction Particles
oxidoreductase NAD-binding domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145460.2-1677s21c1
Sequence:CCGGCCACATAAGCAAGTTACAGAACTCGAGTTCTGTAACTTGCTTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145460.2-1038s21c1
Sequence:CCGGCTGAGAAGATTTCTTGCAGTTCTCGAGAACTGCAAGAAATCTTCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145460.2-942s21c1
Sequence:CCGGGCTATGAGATAGGGACAGTAACTCGAGTTACTGTCCCTATCTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145460.2-1521s21c1
Sequence:CCGGGCCACATTTCAGATTGCCATACTCGAGTATGGCAATCTGAAATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145460.1-1297s1c1
Sequence:CCGGGCCACATTTCAGATTGCCATACTCGAGTATGGCAATCTGAAATGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145460.1-720s1c1
Sequence:CCGGGCTATGAGATAGGGACAGTAACTCGAGTTACTGTCCCTATCTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145460.1-816s1c1
Sequence:CCGGCTGAGAAGATTTCTTGCAGTTCTCGAGAACTGCAAGAAATCTTCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145460.1-1453s1c1
Sequence:CCGGCCACATAAGCAAGTTACAGAACTCGAGTTCTGTAACTTGCTTATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138381
VALIDATED
OXNAD1 MISSION shRNA Bacterial Glycerol Stock
oxidoreductase NAD-binding domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-553s21c1
Sequence:CCGGTTTGCGCCACCTTACTCTAACCTCGAGGTTAGAGTAAGGTGGCGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-1260s21c1
Sequence:CCGGAGGAGATAAGAGATCATATTTCTCGAGAAATATGATCTCTTATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138381.2-3709s21c1
Sequence:CCGGATGAGTGTGTTGTCGTTATTACTCGAGTAATAACGACAACACACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-982s21c1
Sequence:CCGGTGCAGGAGGAGTCGGAATTAACTCGAGTTAATTCCGACTCCTCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-500s21c1
Sequence:CCGGTCTGTTGGAGCCATCCGTATTCTCGAGAATACGGATGGCTCCAACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-536s1c1
Sequence:CCGGCCTTACTCTAACCAGCATAATCTCGAGATTATGCTGGTTAGAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-675s1c1
Sequence:CCGGCGCTTGCTTGTTGCTGATCAACTCGAGTTGATCAGCAACAAGCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-966s1c1
Sequence:CCGGGTCGGAATTAACCCTCTGCTTCTCGAGAAGCAGAGGGTTAATTCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-715s1c1
Sequence:CCGGGCCAGTGGGTTGATTTCTTTACTCGAGTAAAGAAATCAACCCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-1231s1c1
Sequence:CCGGAGAAGGAGATAAGAGATCATACTCGAGTATGATCTCTTATCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138381
VALIDATED
OXNAD1 MISSION shRNA shRNA Plasmid DNA
oxidoreductase NAD-binding domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-553s21c1
Sequence:CCGGTTTGCGCCACCTTACTCTAACCTCGAGGTTAGAGTAAGGTGGCGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-1260s21c1
Sequence:CCGGAGGAGATAAGAGATCATATTTCTCGAGAAATATGATCTCTTATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138381.2-3709s21c1
Sequence:CCGGATGAGTGTGTTGTCGTTATTACTCGAGTAATAACGACAACACACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-982s21c1
Sequence:CCGGTGCAGGAGGAGTCGGAATTAACTCGAGTTAATTCCGACTCCTCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-500s21c1
Sequence:CCGGTCTGTTGGAGCCATCCGTATTCTCGAGAATACGGATGGCTCCAACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-536s1c1
Sequence:CCGGCCTTACTCTAACCAGCATAATCTCGAGATTATGCTGGTTAGAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-675s1c1
Sequence:CCGGCGCTTGCTTGTTGCTGATCAACTCGAGTTGATCAGCAACAAGCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-966s1c1
Sequence:CCGGGTCGGAATTAACCCTCTGCTTCTCGAGAAGCAGAGGGTTAATTCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-715s1c1
Sequence:CCGGGCCAGTGGGTTGATTTCTTTACTCGAGTAAAGAAATCAACCCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-1231s1c1
Sequence:CCGGAGAAGGAGATAAGAGATCATACTCGAGTATGATCTCTTATCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138381
VALIDATED
OXNAD1 MISSION shRNA Lentiviral Transduction Particles
oxidoreductase NAD-binding domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-553s21c1
Sequence:CCGGTTTGCGCCACCTTACTCTAACCTCGAGGTTAGAGTAAGGTGGCGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-1260s21c1
Sequence:CCGGAGGAGATAAGAGATCATATTTCTCGAGAAATATGATCTCTTATCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138381.2-3709s21c1
Sequence:CCGGATGAGTGTGTTGTCGTTATTACTCGAGTAATAACGACAACACACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-982s21c1
Sequence:CCGGTGCAGGAGGAGTCGGAATTAACTCGAGTTAATTCCGACTCCTCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_138381.2-500s21c1
Sequence:CCGGTCTGTTGGAGCCATCCGTATTCTCGAGAATACGGATGGCTCCAACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-536s1c1
Sequence:CCGGCCTTACTCTAACCAGCATAATCTCGAGATTATGCTGGTTAGAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-675s1c1
Sequence:CCGGCGCTTGCTTGTTGCTGATCAACTCGAGTTGATCAGCAACAAGCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-966s1c1
Sequence:CCGGGTCGGAATTAACCCTCTGCTTCTCGAGAAGCAGAGGGTTAATTCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-715s1c1
Sequence:CCGGGCCAGTGGGTTGATTTCTTTACTCGAGTAAAGAAATCAACCCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_138381.1-1231s1c1
Sequence:CCGGAGAAGGAGATAAGAGATCATACTCGAGTATGATCTCTTATCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)