EMAIL THIS PAGE TO A FRIEND

OXR1

oxidation resistance 1

217 Gene Product Result for
Synonyms: TLDC3
Gene ID:
Mouse(170719) oxidation resistance 1
Rat(117520) oxidation resistance 1
chicken(420270) oxidation resistance 1
dog(481998) oxidation resistance 1
Horse(100063414) oxidation resistance 1
cow(782927) oxidation resistance 1
cow(539092) oxidation resistance 1
domestic cat(101086037) oxidation resistance 1
naked mole-rat(101701845) oxidation resistance 1
Domestic Rabbit(100345410) oxidation resistance 1
domestic guinea pig(100732909) oxidation resistance 1
sheep(101120252) oxidation resistance 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181354 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181354 Rosetta Predictions human pricing
NM_057153 Rosetta Predictions rat pricing
NM_001130163 Rosetta Predictions mouse pricing
NM_001130164 Rosetta Predictions mouse pricing
NM_001130165 Rosetta Predictions mouse pricing
NM_001130166 Rosetta Predictions mouse pricing
NM_130885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209070 predicted 384
2 SASI_Hs01_00209072 predicted 2543
3 SASI_Hs02_00370020 predicted 1709
4 SASI_Hs01_00209073 predicted 1358
5 SASI_Hs01_00209075 predicted 447
6 SASI_Hs01_00209076 predicted 1939
7 SASI_Hs02_00370021 predicted 1225
8 SASI_Hs01_00209077 predicted 655
9 SASI_Hs02_00370022 predicted 2665
10 SASI_Hs02_00370023 predicted 802
11 SASI_Hs01_00209071 predicted 794
12 SASI_Hs01_00209074 predicted 1330
13 SASI_Hs01_00209078 predicted 1809
14 SASI_Hs01_00209079 predicted 2055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267111 predicted 440
2 SASI_Rn02_00267112 predicted 492
3 SASI_Rn02_00267113 predicted 2749
4 SASI_Rn02_00267114 predicted 1370
5 SASI_Rn02_00267115 predicted 1446
6 SASI_Rn02_00267116 predicted 1445
7 SASI_Rn02_00267117 predicted 2730
8 SASI_Rn02_00267118 predicted 1783
9 SASI_Rn02_00267119 predicted 1365
10 SASI_Rn02_00267120 predicted 2747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310898 predicted 2477
2 SASI_Mm02_00310899 predicted 2482
3 SASI_Mm02_00310900 predicted 2099
4 SASI_Mm02_00310901 predicted 2456
5 SASI_Mm02_00310902 predicted 2569
6 SASI_Mm02_00310903 predicted 2120
7 SASI_Mm02_00310904 predicted 2673
8 SASI_Mm02_00310905 predicted 2362
9 SASI_Mm02_00310906 predicted 2631
10 SASI_Mm02_00310907 predicted 2370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310908 predicted 825
2 SASI_Mm02_00310909 predicted 836
3 SASI_Mm02_00310910 predicted 451
4 SASI_Mm02_00310911 predicted 806
5 SASI_Mm02_00310912 predicted 916
6 SASI_Mm02_00310913 predicted 468
7 SASI_Mm02_00310914 predicted 1027
8 SASI_Mm02_00310915 predicted 715
9 SASI_Mm02_00310916 predicted 985
10 SASI_Mm02_00310917 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310918 predicted 2571
2 SASI_Mm02_00310919 predicted 2577
3 SASI_Mm02_00310920 predicted 2199
4 SASI_Mm02_00310921 predicted 2546
5 SASI_Mm02_00310922 predicted 2655
6 SASI_Mm02_00310923 predicted 2207
7 SASI_Mm02_00310924 predicted 2770
8 SASI_Mm02_00310925 predicted 2455
9 SASI_Mm02_00310926 predicted 2725
10 SASI_Mm02_00310927 predicted 2468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310928 predicted 2915
2 SASI_Mm02_00310929 predicted 2925
3 SASI_Mm02_00310930 predicted 2545
4 SASI_Mm02_00310931 predicted 2894
5 SASI_Mm02_00310932 predicted 3004
6 SASI_Mm02_00310933 predicted 2553
7 SASI_Mm02_00310934 predicted 3115
8 SASI_Mm02_00310935 predicted 2798
9 SASI_Mm02_00310936 predicted 3071
10 SASI_Mm02_00310937 predicted 2815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129798 predicted 2550
2 SASI_Mm01_00129799 predicted 2566
3 SASI_Mm02_00338316 predicted 2183
4 SASI_Mm01_00129804 predicted 2532
5 SASI_Mm02_00338317 predicted 2644
6 SASI_Mm01_00129805 predicted 2200
7 SASI_Mm02_00338318 predicted 2759
8 SASI_Mm02_00338319 predicted 2443
9 SASI_Mm02_00338320 predicted 2713
10 SASI_Mm02_00338321 predicted 2450
11 SASI_Mm01_00129796 predicted 593
12 SASI_Mm01_00129797 predicted 238
13 SASI_Mm01_00129800 predicted 1850
14 SASI_Mm01_00129801 predicted 1537
15 SASI_Mm01_00129802 predicted 746
16 SASI_Mm01_00129803 predicted 1892
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130885
VALIDATED
OXR1 MISSION shRNA Bacterial Glycerol Stock
oxidation resistance 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130885.2-1534s21c1
Sequence:CCGGCCTATGTCTCAGAGTCGGAAACTCGAGTTTCCGACTCTGAGACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-2934s1c1
Sequence:CCGGGCCTACTTACATTTAGTTCTACTCGAGTAGAACTAAATGTAAGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-1533s1c1
Sequence:CCGGCCTATGTCTCAGAGTCGGAAACTCGAGTTTCCGACTCTGAGACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-238s1c1
Sequence:CCGGCCCAATGAACTTGTTCAGTTACTCGAGTAACTGAACAAGTTCATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-1734s1c1
Sequence:CCGGGCCTGGATTCATAGTAGTCAACTCGAGTTGACTACTATGAATCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130885.2-2935s21c1
Sequence:CCGGGCCTACTTACATTTAGTTCTACTCGAGTAGAACTAAATGTAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130885.2-239s21c1
Sequence:CCGGCCCAATGAACTTGTTCAGTTACTCGAGTAACTGAACAAGTTCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130885.2-1735s21c1
Sequence:CCGGGCCTGGATTCATAGTAGTCAACTCGAGTTGACTACTATGAATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130885
VALIDATED
OXR1 MISSION shRNA shRNA Plasmid DNA
oxidation resistance 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130885.2-1534s21c1
Sequence:CCGGCCTATGTCTCAGAGTCGGAAACTCGAGTTTCCGACTCTGAGACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-2934s1c1
Sequence:CCGGGCCTACTTACATTTAGTTCTACTCGAGTAGAACTAAATGTAAGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-1533s1c1
Sequence:CCGGCCTATGTCTCAGAGTCGGAAACTCGAGTTTCCGACTCTGAGACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-238s1c1
Sequence:CCGGCCCAATGAACTTGTTCAGTTACTCGAGTAACTGAACAAGTTCATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-1734s1c1
Sequence:CCGGGCCTGGATTCATAGTAGTCAACTCGAGTTGACTACTATGAATCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130885.2-2935s21c1
Sequence:CCGGGCCTACTTACATTTAGTTCTACTCGAGTAGAACTAAATGTAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130885.2-239s21c1
Sequence:CCGGCCCAATGAACTTGTTCAGTTACTCGAGTAACTGAACAAGTTCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130885.2-1735s21c1
Sequence:CCGGGCCTGGATTCATAGTAGTCAACTCGAGTTGACTACTATGAATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130885
VALIDATED
OXR1 MISSION shRNA Lentiviral Transduction Particles
oxidation resistance 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130885.2-1534s21c1
Sequence:CCGGCCTATGTCTCAGAGTCGGAAACTCGAGTTTCCGACTCTGAGACATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-2934s1c1
Sequence:CCGGGCCTACTTACATTTAGTTCTACTCGAGTAGAACTAAATGTAAGTAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-1533s1c1
Sequence:CCGGCCTATGTCTCAGAGTCGGAAACTCGAGTTTCCGACTCTGAGACATAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-238s1c1
Sequence:CCGGCCCAATGAACTTGTTCAGTTACTCGAGTAACTGAACAAGTTCATTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130885.1-1734s1c1
Sequence:CCGGGCCTGGATTCATAGTAGTCAACTCGAGTTGACTACTATGAATCCAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130885.2-2935s21c1
Sequence:CCGGGCCTACTTACATTTAGTTCTACTCGAGTAGAACTAAATGTAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130885.2-239s21c1
Sequence:CCGGCCCAATGAACTTGTTCAGTTACTCGAGTAACTGAACAAGTTCATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130885.2-1735s21c1
Sequence:CCGGGCCTGGATTCATAGTAGTCAACTCGAGTTGACTACTATGAATCCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181354
VALIDATED
OXR1 MISSION shRNA Bacterial Glycerol Stock
oxidation resistance 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181354.4-2071s21c1
Sequence:CCGCCAATTGAGGATTCTAGTAATCCTCGAGGATTACTAGAATCCTCAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-657s1c1
Sequence:CCGGCCTCATCTACTTTCACTGGTACTCGAGTACCAGTGAAAGTAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-1943s1c1
Sequence:CCGGGCAGAAGATACTGGCGAATATCTCGAGATATTCGCCAGTATCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-455s1c1
Sequence:CCGGCCTAACGAACTTGTTCAATTACTCGAGTAATTGAACAAGTTCGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181354.4-2030s21c1
Sequence:CCGGACCTGGATTTATAGTAGTAAACTCGAGTTTACTACTATAAATCCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-1753s1c1
Sequence:CCGGGCATCGATTACATAAGTTCTTCTCGAGAAGAACTTATGTAATCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181354.2-1358s1c1
Sequence:CCGGGCCATTAAGGAAGATCAGATTCTCGAGAATCTGATCTTCCTTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181354.2-2579s1c1
Sequence:CCGGCGTACACTTTCTAAGAAGGAACTCGAGTTCCTTCTTAGAAAGTGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-957s1c1
Sequence:CCGGCCATAGATATAGATCAGCTATCTCGAGATAGCTGATCTATATCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-1623s1c1
Sequence:CCGGCCCATACTATGCAACAAACTACTCGAGTAGTTTGTTGCATAGTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181354.4-1099s21c1
Sequence:CCGGGAATCCGAGATGCAGGTAATGCTCGAGCATTACCTGCATCTCGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181354.4-2809s21c1
Sequence:CCGGATTAGTCTGTATCACCATTTACTCGAGTAAATGGTGATACAGACTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181354
VALIDATED
OXR1 MISSION shRNA shRNA Plasmid DNA
oxidation resistance 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181354.4-2071s21c1
Sequence:CCGCCAATTGAGGATTCTAGTAATCCTCGAGGATTACTAGAATCCTCAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-657s1c1
Sequence:CCGGCCTCATCTACTTTCACTGGTACTCGAGTACCAGTGAAAGTAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-1943s1c1
Sequence:CCGGGCAGAAGATACTGGCGAATATCTCGAGATATTCGCCAGTATCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-455s1c1
Sequence:CCGGCCTAACGAACTTGTTCAATTACTCGAGTAATTGAACAAGTTCGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181354.4-2030s21c1
Sequence:CCGGACCTGGATTTATAGTAGTAAACTCGAGTTTACTACTATAAATCCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-1753s1c1
Sequence:CCGGGCATCGATTACATAAGTTCTTCTCGAGAAGAACTTATGTAATCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181354.2-1358s1c1
Sequence:CCGGGCCATTAAGGAAGATCAGATTCTCGAGAATCTGATCTTCCTTAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181354.2-2579s1c1
Sequence:CCGGCGTACACTTTCTAAGAAGGAACTCGAGTTCCTTCTTAGAAAGTGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-957s1c1
Sequence:CCGGCCATAGATATAGATCAGCTATCTCGAGATAGCTGATCTATATCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-1623s1c1
Sequence:CCGGCCCATACTATGCAACAAACTACTCGAGTAGTTTGTTGCATAGTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181354.4-1099s21c1
Sequence:CCGGGAATCCGAGATGCAGGTAATGCTCGAGCATTACCTGCATCTCGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181354.4-2809s21c1
Sequence:CCGGATTAGTCTGTATCACCATTTACTCGAGTAAATGGTGATACAGACTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181354
VALIDATED
OXR1 MISSION shRNA Lentiviral Transduction Particles
oxidation resistance 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181354.4-2071s21c1
Sequence:CCGCCAATTGAGGATTCTAGTAATCCTCGAGGATTACTAGAATCCTCAATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-657s1c1
Sequence:CCGGCCTCATCTACTTTCACTGGTACTCGAGTACCAGTGAAAGTAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-1943s1c1
Sequence:CCGGGCAGAAGATACTGGCGAATATCTCGAGATATTCGCCAGTATCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-455s1c1
Sequence:CCGGCCTAACGAACTTGTTCAATTACTCGAGTAATTGAACAAGTTCGTTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181354.4-2030s21c1
Sequence:CCGGACCTGGATTTATAGTAGTAAACTCGAGTTTACTACTATAAATCCAGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-1753s1c1
Sequence:CCGGGCATCGATTACATAAGTTCTTCTCGAGAAGAACTTATGTAATCGATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181354.2-1358s1c1
Sequence:CCGGGCCATTAAGGAAGATCAGATTCTCGAGAATCTGATCTTCCTTAATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181354.2-2579s1c1
Sequence:CCGGCGTACACTTTCTAAGAAGGAACTCGAGTTCCTTCTTAGAAAGTGTACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-957s1c1
Sequence:CCGGCCATAGATATAGATCAGCTATCTCGAGATAGCTGATCTATATCTATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181354.2-1623s1c1
Sequence:CCGGCCCATACTATGCAACAAACTACTCGAGTAGTTTGTTGCATAGTATGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181354.4-1099s21c1
Sequence:CCGGGAATCCGAGATGCAGGTAATGCTCGAGCATTACCTGCATCTCGGATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181354.4-2809s21c1
Sequence:CCGGATTAGTCTGTATCACCATTTACTCGAGTAAATGGTGATACAGACTAATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)