EMAIL THIS PAGE TO A FRIEND

OXSM

3-oxoacyl-ACP synthase, mitochondrial

55 Gene Product Result for
Synonyms: FASN2D KASI KS
UniProtKB ID: Q9NWU1
Gene ID:
Human(54995) Summary: This gene encodes a beta-ketoacyl synthetase. The encoded enzyme is required for elongation of fatty acid chains in the mitochondria. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2009]
Mouse(71147) 3-oxoacyl-ACP synthase, mitochondrial
Rat(289934) 3-oxoacyl-ACP synthase, mitochondrial
chicken(420656) 3-oxoacyl-ACP synthase, mitochondrial
Horse(100051475) 3-oxoacyl-ACP synthase, mitochondrial
cow(513530) 3-oxoacyl-ACP synthase, mitochondrial
domestic cat(101089208) 3-oxoacyl-ACP synthase, mitochondrial
dog(477043) 3-oxoacyl-ACP synthase, mitochondrial
Goat(100861103) 3-oxoacyl-ACP synthase, mitochondrial
sheep(101121911) 3-oxoacyl-ACP synthase, mitochondrial
domestic guinea pig(100720851) 3-oxoacyl-ACP synthase, mitochondrial
Domestic Rabbit(100338502) 3-oxoacyl-ACP synthase, mitochondrial
naked mole-rat(101725724) 3-oxoacyl-ACP synthase, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017897 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_127578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017897 Rosetta Predictions human pricing
XM_001062014 Rosetta Predictions rat pricing
NM_027695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159103 predicted 242
2 SASI_Hs01_00159104 predicted 200
3 SASI_Hs01_00159105 predicted 376
4 SASI_Hs01_00159106 predicted 748
5 SASI_Hs01_00159107 predicted 947
6 SASI_Hs01_00159110 predicted 1137
7 SASI_Hs01_00159111 predicted 204
8 SASI_Hs02_00350871 predicted 560
9 SASI_Hs01_00159112 predicted 966
10 SASI_Hs02_00350872 predicted 580
11 SASI_Hs01_00159108 predicted 823
12 SASI_Hs01_00159109 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302069 predicted 1496
2 SASI_Rn02_00302070 predicted 1597
3 SASI_Rn02_00302071 predicted 1580
4 SASI_Rn02_00302072 predicted 1544
5 SASI_Rn02_00302073 predicted 1656
6 SASI_Rn02_00302074 predicted 1615
7 SASI_Rn02_00302075 predicted 1836
8 SASI_Rn02_00302076 predicted 1743
9 SASI_Rn02_00302077 predicted 1684
10 SASI_Rn02_00302078 predicted 1698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169187 predicted 1365
2 SASI_Mm01_00169188 predicted 421
3 SASI_Mm01_00169189 predicted 394
4 SASI_Mm01_00169190 predicted 1385
5 SASI_Mm01_00169191 predicted 1017
6 SASI_Mm01_00169192 predicted 1806
7 SASI_Mm01_00169193 predicted 1084
8 SASI_Mm01_00169194 predicted 405
9 SASI_Mm01_00169195 predicted 1064
10 SASI_Mm01_00169196 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017897
VALIDATED
OXSM MISSION shRNA Bacterial Glycerol Stock
3-oxoacyl-ACP synthase, mitochondrial
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-1296s21c1
Sequence:CCGGTTTACCACATTAGCTTGTTATCTCGAGATAACAAGCTAATGTGGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-1031s21c1
Sequence:CCGGAGGTGATGCTGGTCACATAACCTCGAGGTTATGTGACCAGCATCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-756s21c1
Sequence:CCAGGGAGACTCATTTAGATTTATACTCGAGTATAAATCTAAATGAGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-1071s21c1
Sequence:CCGGGAAGGTGCCTTAAGGTGTATGCTCGAGCATACACCTTAAGGCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-394s21c1
Sequence:CCGGGTGATGAAGGTCAGTTCAATGCTCGAGCATTGAACTGACCTTCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017897.1-137s1c1
Sequence:CCGGGCACTCGTCTTCTATGTTCAACTCGAGTTGAACATAGAAGACGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-226s1c1
Sequence:CCGGCGAGTTGTCATTACAGGCATTCTCGAGAATGCCTGTAATGACAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-1218s1c1
Sequence:CCGGCCTTGCAGTTTCCTCAACTAACTCGAGTTAGTTGAGGAAACTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-986s1c1
Sequence:CCGGCCCGGATCTATGCAGAAGTTTCTCGAGAAACTTCTGCATAGATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-1351s1c1
Sequence:CCGGCCAGAATTTGATCTCAACTATCTCGAGATAGTTGAGATCAAATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-807s21c1
Sequence:CCGGGGAGGTACAGATTCTTGTATTCTCGAGAATACAAGAATCTGTACCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-537s21c1
Sequence:CCGGGTGGCTACTGGTGTTGCAATTCTCGAGAATTGCAACACCAGTAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017897
VALIDATED
OXSM MISSION shRNA shRNA Plasmid DNA
3-oxoacyl-ACP synthase, mitochondrial
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-1296s21c1
Sequence:CCGGTTTACCACATTAGCTTGTTATCTCGAGATAACAAGCTAATGTGGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-1031s21c1
Sequence:CCGGAGGTGATGCTGGTCACATAACCTCGAGGTTATGTGACCAGCATCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-756s21c1
Sequence:CCAGGGAGACTCATTTAGATTTATACTCGAGTATAAATCTAAATGAGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-1071s21c1
Sequence:CCGGGAAGGTGCCTTAAGGTGTATGCTCGAGCATACACCTTAAGGCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-394s21c1
Sequence:CCGGGTGATGAAGGTCAGTTCAATGCTCGAGCATTGAACTGACCTTCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017897.1-137s1c1
Sequence:CCGGGCACTCGTCTTCTATGTTCAACTCGAGTTGAACATAGAAGACGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-226s1c1
Sequence:CCGGCGAGTTGTCATTACAGGCATTCTCGAGAATGCCTGTAATGACAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-1218s1c1
Sequence:CCGGCCTTGCAGTTTCCTCAACTAACTCGAGTTAGTTGAGGAAACTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-986s1c1
Sequence:CCGGCCCGGATCTATGCAGAAGTTTCTCGAGAAACTTCTGCATAGATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-1351s1c1
Sequence:CCGGCCAGAATTTGATCTCAACTATCTCGAGATAGTTGAGATCAAATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-807s21c1
Sequence:CCGGGGAGGTACAGATTCTTGTATTCTCGAGAATACAAGAATCTGTACCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-537s21c1
Sequence:CCGGGTGGCTACTGGTGTTGCAATTCTCGAGAATTGCAACACCAGTAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017897
VALIDATED
OXSM MISSION shRNA Lentiviral Transduction Particles
3-oxoacyl-ACP synthase, mitochondrial
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-1296s21c1
Sequence:CCGGTTTACCACATTAGCTTGTTATCTCGAGATAACAAGCTAATGTGGTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-1031s21c1
Sequence:CCGGAGGTGATGCTGGTCACATAACCTCGAGGTTATGTGACCAGCATCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-756s21c1
Sequence:CCAGGGAGACTCATTTAGATTTATACTCGAGTATAAATCTAAATGAGTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-1071s21c1
Sequence:CCGGGAAGGTGCCTTAAGGTGTATGCTCGAGCATACACCTTAAGGCACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-394s21c1
Sequence:CCGGGTGATGAAGGTCAGTTCAATGCTCGAGCATTGAACTGACCTTCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017897.1-137s1c1
Sequence:CCGGGCACTCGTCTTCTATGTTCAACTCGAGTTGAACATAGAAGACGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-226s1c1
Sequence:CCGGCGAGTTGTCATTACAGGCATTCTCGAGAATGCCTGTAATGACAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-1218s1c1
Sequence:CCGGCCTTGCAGTTTCCTCAACTAACTCGAGTTAGTTGAGGAAACTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-986s1c1
Sequence:CCGGCCCGGATCTATGCAGAAGTTTCTCGAGAAACTTCTGCATAGATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_017897.1-1351s1c1
Sequence:CCGGCCAGAATTTGATCTCAACTATCTCGAGATAGTTGAGATCAAATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-807s21c1
Sequence:CCGGGGAGGTACAGATTCTTGTATTCTCGAGAATACAAGAATCTGTACCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017897.2-537s21c1
Sequence:CCGGGTGGCTACTGGTGTTGCAATTCTCGAGAATTGCAACACCAGTAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027695
OXSM MISSION shRNA Bacterial Glycerol Stock
3-oxoacyl-ACP synthase, mitochondrial
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027695.3-409s21c1
Sequence:CCGGCATCCATATCCAGCGTCATATCTCGAGATATGACGCTGGATATGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027695.3-1248s21c1
Sequence:CCGGAGCTCGGATCTACGCAGAAATCTCGAGATTTCTGCGTAGATCCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027695.3-2096s21c1
Sequence:CCGGCACTGTTGTACAGCATATAAACTCGAGTTTATATGCTGTACAACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027695
OXSM MISSION shRNA shRNA Plasmid DNA
3-oxoacyl-ACP synthase, mitochondrial
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027695.3-409s21c1
Sequence:CCGGCATCCATATCCAGCGTCATATCTCGAGATATGACGCTGGATATGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027695.3-1248s21c1
Sequence:CCGGAGCTCGGATCTACGCAGAAATCTCGAGATTTCTGCGTAGATCCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027695.3-2096s21c1
Sequence:CCGGCACTGTTGTACAGCATATAAACTCGAGTTTATATGCTGTACAACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027695
OXSM MISSION shRNA Lentiviral Transduction Particles
3-oxoacyl-ACP synthase, mitochondrial
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027695.3-409s21c1
Sequence:CCGGCATCCATATCCAGCGTCATATCTCGAGATATGACGCTGGATATGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027695.3-1248s21c1
Sequence:CCGGAGCTCGGATCTACGCAGAAATCTCGAGATTTCTGCGTAGATCCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027695.3-2096s21c1
Sequence:CCGGCACTGTTGTACAGCATATAAACTCGAGTTTATATGCTGTACAACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127578
OXSM MISSION shRNA Bacterial Glycerol Stock
3-oxoacyl-ACP synthase, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-598s1c1
Sequence:CCGGCCATTCTTTGTCCCTAAGATTCTCGAGAATCTTAGGGACAAAGAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-955s1c1
Sequence:CCGGGCTCGGATCTACGCAGAAATTCTCGAGAATTTCTGCGTAGATCCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-1320s1c1
Sequence:CCGGGCCTGAATTTGATCTCAATTACTCGAGTAATTGAGATCAAATTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-1378s1c1
Sequence:CCGGCGGTGTATTGGACTCACCAATCTCGAGATTGGTGAGTCCAATACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-127s1c1
Sequence:CCGGGCGTCATATTCTTGGTTAATACTCGAGTATTAACCAAGAATATGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127578
OXSM MISSION shRNA shRNA Plasmid DNA
3-oxoacyl-ACP synthase, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-598s1c1
Sequence:CCGGCCATTCTTTGTCCCTAAGATTCTCGAGAATCTTAGGGACAAAGAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-955s1c1
Sequence:CCGGGCTCGGATCTACGCAGAAATTCTCGAGAATTTCTGCGTAGATCCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-1320s1c1
Sequence:CCGGGCCTGAATTTGATCTCAATTACTCGAGTAATTGAGATCAAATTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-1378s1c1
Sequence:CCGGCGGTGTATTGGACTCACCAATCTCGAGATTGGTGAGTCCAATACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-127s1c1
Sequence:CCGGGCGTCATATTCTTGGTTAATACTCGAGTATTAACCAAGAATATGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127578
OXSM MISSION shRNA Lentiviral Transduction Particles
3-oxoacyl-ACP synthase, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-598s1c1
Sequence:CCGGCCATTCTTTGTCCCTAAGATTCTCGAGAATCTTAGGGACAAAGAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-955s1c1
Sequence:CCGGGCTCGGATCTACGCAGAAATTCTCGAGAATTTCTGCGTAGATCCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-1320s1c1
Sequence:CCGGGCCTGAATTTGATCTCAATTACTCGAGTAATTGAGATCAAATTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-1378s1c1
Sequence:CCGGCGGTGTATTGGACTCACCAATCTCGAGATTGGTGAGTCCAATACACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127578.2-127s1c1
Sequence:CCGGGCGTCATATTCTTGGTTAATACTCGAGTATTAACCAAGAATATGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)