EMAIL THIS PAGE TO A FRIEND

OXSR1

oxidative stress responsive 1

204 Gene Product Result for
Synonyms: OSR1
UniProtKB ID: O95747, Q3LR53, Q7Z501, Q9UPQ1
Gene ID:
Human(9943) Summary: The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Mouse(108737) oxidative-stress responsive 1
Rat(316064) oxidative-stress responsive 1
naked mole-rat(101714901) oxidative stress responsive 1
sheep(101110880) oxidative-stress responsive 1
chicken(420421) oxidative-stress responsive 1
cow(526949) oxidative-stress responsive 1
Horse(100050017) oxidative-stress responsive 1
domestic cat(101080733) oxidative-stress responsive 1
dog(607809) oxidative-stress responsive 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302230 ANTI-MOUSE OXSR1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB4503743 Anti-OSR1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
HPA008237 Anti-OXSR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503744 Anti-OXSR1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB2106818 Anti-OXSR1 antibody produced in rabbit affinity isolated antibody bovine, rat, dog, human, guinea pig, horse
western blot pricing
SAB1411706 Anti-OXSR1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4504630 Anti-phospho-OSR1 (pThr185) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301307 Anti-phospho-OSR1 (pThr185) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
WH0009943M16 Monoclonal Anti-OXSR1 antibody produced in mouse clone 3A8, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404767 Monoclonal Anti-OXSR1 antibody produced in mouse clone 1B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1410032 Monoclonal Anti-OXSR1 antibody produced in mouse clone 4G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1410033 Monoclonal Anti-OXSR1 antibody produced in mouse clone 5E1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1410034 Monoclonal Anti-OXSR1 antibody produced in mouse clone 2E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1410035 Monoclonal Anti-OXSR1 antibody produced in mouse clone 1F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1410036 Monoclonal Anti-OXSR1 antibody produced in mouse clone 4D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1410037 Monoclonal Anti-OXSR1 antibody produced in mouse clone 2A2-1A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1410038 Monoclonal Anti-OXSR1 antibody produced in mouse clone 4C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1410039 Monoclonal Anti-OXSR1 antibody produced in mouse clone 1C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1410040 Monoclonal Anti-OXSR1 antibody produced in mouse clone 1C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1410041 Monoclonal Anti-OXSR1 antibody produced in mouse clone 5D5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1410042 Monoclonal Anti-OXSR1 antibody produced in mouse clone 3F6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1410043 Monoclonal Anti-OXSR1 antibody produced in mouse clone 2A5, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB1410044 Monoclonal Anti-OXSR1 antibody produced in mouse clone 1B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1410045 Monoclonal Anti-OXSR1 antibody produced in mouse clone 1D10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005109 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_135264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005109 siRNAs that have been validated in the lab human pricing
NM_001108194 Rosetta Predictions rat pricing
NM_133985 Rosetta Predictions mouse pricing
XM_135264 Rosetta Predictions mouse pricing
XM_902947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005109 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142335 validated 1963
1 SASI_Hs01_00142337 validated 1643
1 SASI_Hs01_00142336 validated 1867
2 SASI_Hs01_00142338 predicted 1180
3 SASI_Hs01_00142339 predicted 1891
4 SASI_Hs01_00142340 predicted 1774
5 SASI_Hs02_00338997 predicted 1529
6 SASI_Hs01_00142341 predicted 1625
7 SASI_Hs01_00142342 predicted 455
8 SASI_Hs01_00142343 predicted 552
9 SASI_Hs01_00142344 predicted 1825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236254 predicted 1727
2 SASI_Rn02_00236255 predicted 504
3 SASI_Rn02_00236256 predicted 1850
4 SASI_Rn02_00236257 predicted 778
5 SASI_Rn02_00236258 predicted 518
6 SASI_Rn02_00236259 predicted 1591
7 SASI_Rn02_00236260 predicted 424
8 SASI_Rn02_00236261 predicted 1655
9 SASI_Rn02_00236262 predicted 1770
10 SASI_Rn02_00236263 predicted 1802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339114 predicted 653
2 SASI_Mm02_00339115 predicted 595
3 SASI_Mm02_00339116 predicted 350
4 SASI_Mm02_00339117 predicted 1169
5 SASI_Mm02_00339118 predicted 1166
6 SASI_Mm02_00339119 predicted 595
7 SASI_Mm02_00339120 predicted 1275
8 SASI_Mm02_00339121 predicted 1151
9 SASI_Mm02_00339122 predicted 494
10 SASI_Mm02_00339123 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256473 predicted 1651
2 SASI_Mm01_00256474 predicted 418
3 SASI_Mm01_00256475 predicted 570
4 SASI_Mm01_00256476 predicted 1094
5 SASI_Mm01_00256477 predicted 487
6 SASI_Mm01_00256478 predicted 522
7 SASI_Mm01_00256479 predicted 1663
8 SASI_Mm01_00256480 predicted 1664
9 SASI_Mm01_00256481 predicted 1091
10 SASI_Mm01_00256482 predicted 1773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252375 predicted 1730
2 SASI_Mm01_00252376 predicted 1172
3 SASI_Mm01_00252377 predicted 1768
4 SASI_Mm01_00252378 predicted 1274
5 SASI_Mm01_00252379 predicted 1734
6 SASI_Mm01_00252380 predicted 1167
7 SASI_Mm01_00252381 predicted 1844
8 SASI_Mm01_00252382 predicted 1724
9 SASI_Mm01_00252383 predicted 1070
10 SASI_Mm01_00252384 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005109
VALIDATED
OXSR1 MISSION shRNA Bacterial Glycerol Stock
oxidative stress responsive 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-1879s1c1
Sequence:CCGGCCTGATGATGGTAAACTGATACTCGAGTATCAGTTTACCATCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-551s1c1
Sequence:CCGGGCCATCATCCTAATATTGTATCTCGAGATACAATATTAGGATGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-1189s1c1
Sequence:CCGGGCAGAACTATTAAGGCACAAACTCGAGTTTGTGCCTTAATAGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005109.2-3067s1c1
Sequence:CCGGGAGCACTCATAATGCAATATGCTCGAGCATATTGCATTATGAGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-1969s1c1
Sequence:CCGGGCGTATCTCTGTTGCTTCTATCTCGAGATAGAAGCAACAGAGATACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-633s21c1
Sequence:CCGGAGGTTCTGTTCTGGATATTATCTCGAGATAATATCCAGAACAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-1780s21c1
Sequence:CCGGGTAATAGTGGCAGCTAATTTGCTCGAGCAAATTAGCTGCCACTATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005109.2-1767s1c1
Sequence:CCGGCGGAAGGGATTTAGTAATAGTCTCGAGACTATTACTAAATCCCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-4272s21c1
Sequence:GTACCGGTGGTCTTTCTAAACGACTAAACTCGAGTTTAGTCGTTTAGAAAGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-854s21c1
Sequence:CCGGTAGCAACTGGTGGTGATATTACTCGAGTAATATCACCACCAGTTGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-469s21c1
Sequence:CCGGGTGGCAATCAAACGGATAAACCTCGAGGTTTATCCGTTTGATTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005109
VALIDATED
OXSR1 MISSION shRNA shRNA Plasmid DNA
oxidative stress responsive 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-1879s1c1
Sequence:CCGGCCTGATGATGGTAAACTGATACTCGAGTATCAGTTTACCATCATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-551s1c1
Sequence:CCGGGCCATCATCCTAATATTGTATCTCGAGATACAATATTAGGATGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-1189s1c1
Sequence:CCGGGCAGAACTATTAAGGCACAAACTCGAGTTTGTGCCTTAATAGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005109.2-3067s1c1
Sequence:CCGGGAGCACTCATAATGCAATATGCTCGAGCATATTGCATTATGAGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-1969s1c1
Sequence:CCGGGCGTATCTCTGTTGCTTCTATCTCGAGATAGAAGCAACAGAGATACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-633s21c1
Sequence:CCGGAGGTTCTGTTCTGGATATTATCTCGAGATAATATCCAGAACAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-1780s21c1
Sequence:CCGGGTAATAGTGGCAGCTAATTTGCTCGAGCAAATTAGCTGCCACTATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005109.2-1767s1c1
Sequence:CCGGCGGAAGGGATTTAGTAATAGTCTCGAGACTATTACTAAATCCCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-4272s21c1
Sequence:GTACCGGTGGTCTTTCTAAACGACTAAACTCGAGTTTAGTCGTTTAGAAAGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-854s21c1
Sequence:CCGGTAGCAACTGGTGGTGATATTACTCGAGTAATATCACCACCAGTTGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-469s21c1
Sequence:CCGGGTGGCAATCAAACGGATAAACCTCGAGGTTTATCCGTTTGATTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005109
VALIDATED
OXSR1 MISSION shRNA Lentiviral Transduction Particles
oxidative stress responsive 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-1879s1c1
Sequence:CCGGCCTGATGATGGTAAACTGATACTCGAGTATCAGTTTACCATCATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-551s1c1
Sequence:CCGGGCCATCATCCTAATATTGTATCTCGAGATACAATATTAGGATGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-1189s1c1
Sequence:CCGGGCAGAACTATTAAGGCACAAACTCGAGTTTGTGCCTTAATAGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005109.2-3067s1c1
Sequence:CCGGGAGCACTCATAATGCAATATGCTCGAGCATATTGCATTATGAGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005109.x-1969s1c1
Sequence:CCGGGCGTATCTCTGTTGCTTCTATCTCGAGATAGAAGCAACAGAGATACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-633s21c1
Sequence:CCGGAGGTTCTGTTCTGGATATTATCTCGAGATAATATCCAGAACAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-1780s21c1
Sequence:CCGGGTAATAGTGGCAGCTAATTTGCTCGAGCAAATTAGCTGCCACTATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005109.2-1767s1c1
Sequence:CCGGCGGAAGGGATTTAGTAATAGTCTCGAGACTATTACTAAATCCCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-4272s21c1
Sequence:GTACCGGTGGTCTTTCTAAACGACTAAACTCGAGTTTAGTCGTTTAGAAAGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-854s21c1
Sequence:CCGGTAGCAACTGGTGGTGATATTACTCGAGTAATATCACCACCAGTTGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005109.2-469s21c1
Sequence:CCGGGTGGCAATCAAACGGATAAACCTCGAGGTTTATCCGTTTGATTGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135264
VALIDATED
OXSR1 MISSION shRNA Bacterial Glycerol Stock
oxidative stress responsive 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-857s1c1
Sequence:CCGGGTGGTGACATTACCAGAAATACTCGAGTATTTCTGGTAATGTCACCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-1006s1c1
Sequence:CCGGGCAGCTCCTTATCATAAATATCTCGAGATATTTATGATAAGGAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135264.4-1879s1c1
Sequence:CCGGGATGGCAAACTGATAGGATTTCTCGAGAAATCCTATCAGTTTGCCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-744s1c1
Sequence:CCGGCCTGCATAAGAATGGGCAGATCTCGAGATCTGCCCATTCTTATGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-1647s1c1
Sequence:CCGGGCTAAGATTAAGGAATTCCAACTCGAGTTGGAATTCCTTAATCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135264
VALIDATED
OXSR1 MISSION shRNA shRNA Plasmid DNA
oxidative stress responsive 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-857s1c1
Sequence:CCGGGTGGTGACATTACCAGAAATACTCGAGTATTTCTGGTAATGTCACCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-1006s1c1
Sequence:CCGGGCAGCTCCTTATCATAAATATCTCGAGATATTTATGATAAGGAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135264.4-1879s1c1
Sequence:CCGGGATGGCAAACTGATAGGATTTCTCGAGAAATCCTATCAGTTTGCCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-744s1c1
Sequence:CCGGCCTGCATAAGAATGGGCAGATCTCGAGATCTGCCCATTCTTATGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-1647s1c1
Sequence:CCGGGCTAAGATTAAGGAATTCCAACTCGAGTTGGAATTCCTTAATCTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135264
VALIDATED
OXSR1 MISSION shRNA Lentiviral Transduction Particles
oxidative stress responsive 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-857s1c1
Sequence:CCGGGTGGTGACATTACCAGAAATACTCGAGTATTTCTGGTAATGTCACCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-1006s1c1
Sequence:CCGGGCAGCTCCTTATCATAAATATCTCGAGATATTTATGATAAGGAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135264.4-1879s1c1
Sequence:CCGGGATGGCAAACTGATAGGATTTCTCGAGAAATCCTATCAGTTTGCCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-744s1c1
Sequence:CCGGCCTGCATAAGAATGGGCAGATCTCGAGATCTGCCCATTCTTATGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135264.4-1647s1c1
Sequence:CCGGGCTAAGATTAAGGAATTCCAACTCGAGTTGGAATTCCTTAATCTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133985
OXSR1 MISSION shRNA Bacterial Glycerol Stock
oxidative stress responsive 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000319752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-382s21c1
Sequence:CCGGGTGGTGACATTACCAGAAATACTCGAGTATTTCTGGTAATGTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-1172s21c1
Sequence:CCGGGCTAAGATTAAGGAATTCCAACTCGAGTTGGAATTCCTTAATCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-1404s21c1
Sequence:CCGGGATGGCAAACTGATAGGATTTCTCGAGAAATCCTATCAGTTTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-531s21c1
Sequence:CCGGGCAGCTCCTTATCATAAATATCTCGAGATATTTATGATAAGGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133985
OXSR1 MISSION shRNA shRNA Plasmid DNA
oxidative stress responsive 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000319752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-382s21c1
Sequence:CCGGGTGGTGACATTACCAGAAATACTCGAGTATTTCTGGTAATGTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-1172s21c1
Sequence:CCGGGCTAAGATTAAGGAATTCCAACTCGAGTTGGAATTCCTTAATCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-1404s21c1
Sequence:CCGGGATGGCAAACTGATAGGATTTCTCGAGAAATCCTATCAGTTTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-531s21c1
Sequence:CCGGGCAGCTCCTTATCATAAATATCTCGAGATATTTATGATAAGGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133985
OXSR1 MISSION shRNA Lentiviral Transduction Particles
oxidative stress responsive 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000319752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-382s21c1
Sequence:CCGGGTGGTGACATTACCAGAAATACTCGAGTATTTCTGGTAATGTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-1172s21c1
Sequence:CCGGGCTAAGATTAAGGAATTCCAACTCGAGTTGGAATTCCTTAATCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-1404s21c1
Sequence:CCGGGATGGCAAACTGATAGGATTTCTCGAGAAATCCTATCAGTTTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133985.1-531s21c1
Sequence:CCGGGCAGCTCCTTATCATAAATATCTCGAGATATTTATGATAAGGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)