EMAIL THIS PAGE TO A FRIEND

OXT

oxytocin/neurophysin I prepropeptide

63 Gene Product Result for
Synonyms: OT OT-NPI OXT-NPI
UniProtKB ID: P01178, Q3MIG0
Gene ID:
Human(5020) Summary: This gene encodes a precursor protein that is processed to produce oxytocin and neurophysin I. Oxytocin is posterior pituitary hormone which is synthesized as an inactive precursor in the hypothalamus along with its carrier protein neurophysin I. Together with neurophysin, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis, where it is either stored or secreted into the bloodstream. The precursor seems to be activated while it is being transported along the axon to the posterior pituitary. This hormone contracts smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. [provided by RefSeq, Jun 2013]
Mouse(18429) oxytocin
Rat(25504) oxytocin/neurophysin 1 prepropeptide
fruit fly(38288) peptide O-xylosyltransferase
dog(609301) oxytocin, prepropeptide
cow(280888) oxytocin, prepropeptide
Horse(100066842) oxytocin/neurophysin I prepropeptide
chicken(768516) oxytocin, prepro- (neurophysin I)
sheep(443390) oxytocin/neurophysin I prepropeptide
domestic guinea pig(100720178) oxytocin/neurophysin I prepropeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
O6379 Oxytocin acetate salt hydrate ≥97% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000915 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000915 Rosetta Predictions human pricing
NM_012996 Rosetta Predictions rat pricing
NM_011025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062958 predicted 200
2 SASI_Hs02_00303485 predicted 284
3 SASI_Hs02_00303486 predicted 207
4 SASI_Hs02_00303487 predicted 206
5 SASI_Hs02_00303488 predicted 186
6 SASI_Hs01_00062959 predicted 178
7 SASI_Hs01_00062960 predicted 130
8 SASI_Hs01_00062961 predicted 180
9 SASI_Hs01_00062962 predicted 77
10 SASI_Hs01_00062963 predicted 406
11 SASI_Hs01_00062964 predicted 373
12 SASI_Hs01_00062965 predicted 85
13 SASI_Hs01_00062966 predicted 433
14 SASI_Hs01_00062967 predicted 77
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072346 predicted 123
2 SASI_Rn02_00260641 predicted 399
3 SASI_Rn02_00260642 predicted 429
4 SASI_Rn02_00260643 predicted 388
5 SASI_Rn02_00260644 predicted 406
6 SASI_Rn02_00260645 predicted 414
7 SASI_Rn01_00072348 predicted 112
8 SASI_Rn02_00260646 predicted 376
9 SASI_Rn01_00072349 predicted 134
10 SASI_Rn01_00072350 predicted 141
11 SASI_Rn01_00072347 predicted 2573
12 SASI_Rn01_00072351 predicted 2627
13 SASI_Rn01_00072352 predicted 2655
14 SASI_Rn01_00072353 predicted 2586
15 SASI_Rn01_00072354 predicted 2551
16 SASI_Rn01_00072355 predicted 2588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109356 predicted 412
2 SASI_Mm01_00109357 predicted 51
3 SASI_Mm01_00109358 predicted 416
4 SASI_Mm01_00109359 predicted 387
5 SASI_Mm01_00109360 predicted 325
6 SASI_Mm01_00109361 predicted 325
7 SASI_Mm01_00109362 predicted 73
8 SASI_Mm01_00109363 predicted 127
9 SASI_Mm01_00109364 predicted 382
10 SASI_Mm01_00109365 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011025
OXT MISSION shRNA Bacterial Glycerol Stock
oxytocin/neurophysin I prepropeptide
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000249058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-192s21c1
Sequence:CCGGGCTTCGGACCAAGCATCTGCTCTCGAGAGCAGATGCTTGGTCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-82s21c1
Sequence:CCGGTCTGACCTCGGCCTGCTACATCTCGAGATGTAGCAGGCCGAGGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-138s21c1
Sequence:CCGGTGGACCTGGATATGCGCAAGTCTCGAGACTTGCGCATATCCAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-264s21c1
Sequence:CCGGAGGAGGAGAACTACCTGCCTTCTCGAGAAGGCAGGTAGTTCTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011025
OXT MISSION shRNA shRNA Plasmid DNA
oxytocin/neurophysin I prepropeptide
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000249058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-192s21c1
Sequence:CCGGGCTTCGGACCAAGCATCTGCTCTCGAGAGCAGATGCTTGGTCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-82s21c1
Sequence:CCGGTCTGACCTCGGCCTGCTACATCTCGAGATGTAGCAGGCCGAGGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-138s21c1
Sequence:CCGGTGGACCTGGATATGCGCAAGTCTCGAGACTTGCGCATATCCAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-264s21c1
Sequence:CCGGAGGAGGAGAACTACCTGCCTTCTCGAGAAGGCAGGTAGTTCTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011025
OXT MISSION shRNA Lentiviral Transduction Particles
oxytocin/neurophysin I prepropeptide
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000249058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-192s21c1
Sequence:CCGGGCTTCGGACCAAGCATCTGCTCTCGAGAGCAGATGCTTGGTCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-82s21c1
Sequence:CCGGTCTGACCTCGGCCTGCTACATCTCGAGATGTAGCAGGCCGAGGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-138s21c1
Sequence:CCGGTGGACCTGGATATGCGCAAGTCTCGAGACTTGCGCATATCCAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011025.3-264s21c1
Sequence:CCGGAGGAGGAGAACTACCTGCCTTCTCGAGAAGGCAGGTAGTTCTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000915
OXT MISSION shRNA Bacterial Glycerol Stock
oxytocin/neurophysin I prepropeptide
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000242441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-201s21c1
Sequence:CCGGCAATATCTGCTGCGCGGAAGACTCGAGTCTTCCGCGCAGCAGATATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-258s21c1
Sequence:CCGGCTGCCAGGAGGAGAACTACCTCTCGAGAGGTAGTTCTCCTCCTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-213s21c1
Sequence:CCGGCGCGGAAGAGCTGGGCTGCTTCTCGAGAAGCAGCCCAGCTCTTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-87s21c1
Sequence:CCGGCTCCGCCTGCTACATCCAGAACTCGAGTTCTGGATGTAGCAGGCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000915
OXT MISSION shRNA shRNA Plasmid DNA
oxytocin/neurophysin I prepropeptide
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000242441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-201s21c1
Sequence:CCGGCAATATCTGCTGCGCGGAAGACTCGAGTCTTCCGCGCAGCAGATATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-258s21c1
Sequence:CCGGCTGCCAGGAGGAGAACTACCTCTCGAGAGGTAGTTCTCCTCCTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-213s21c1
Sequence:CCGGCGCGGAAGAGCTGGGCTGCTTCTCGAGAAGCAGCCCAGCTCTTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-87s21c1
Sequence:CCGGCTCCGCCTGCTACATCCAGAACTCGAGTTCTGGATGTAGCAGGCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000915
OXT MISSION shRNA Lentiviral Transduction Particles
oxytocin/neurophysin I prepropeptide
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000242441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-201s21c1
Sequence:CCGGCAATATCTGCTGCGCGGAAGACTCGAGTCTTCCGCGCAGCAGATATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-258s21c1
Sequence:CCGGCTGCCAGGAGGAGAACTACCTCTCGAGAGGTAGTTCTCCTCCTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-213s21c1
Sequence:CCGGCGCGGAAGAGCTGGGCTGCTTCTCGAGAAGCAGCCCAGCTCTTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000915.2-87s21c1
Sequence:CCGGCTCCGCCTGCTACATCCAGAACTCGAGTTCTGGATGTAGCAGGCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)