EMAIL THIS PAGE TO A FRIEND

OXTR

oxytocin receptor

70 Gene Product Result for
Synonyms: OT-R
UniProtKB ID: P30559, Q15071
Gene ID:
Human(5021) Summary: The protein encoded by this gene belongs to the G-protein coupled receptor family and acts as a receptor for oxytocin. Its activity is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. The oxytocin-oxytocin receptor system plays an important role in the uterus during parturition. [provided by RefSeq, Jul 2008]
Mouse(18430) oxytocin receptor
Rat(25342) oxytocin receptor
domestic guinea pig(100721402) oxytocin receptor
naked mole-rat(101716873) oxytocin receptor
Domestic Rabbit(100008670) oxytocin receptor
Zebrafish(100001530) oxytocin receptor
chicken(429211) oxytocin receptor
cow(281371) oxytocin receptor
dog(484670) oxytocin receptor
domestic cat(101081711) oxytocin receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_144956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_144956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_144956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU156741 MISSION® esiRNA targeting mouse Oxtr mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000916 Rosetta Predictions human pricing
NM_012871 Rosetta Predictions rat pricing
NM_001081147 Rosetta Predictions mouse pricing
XM_144956 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095308 predicted 1859
2 SASI_Hs01_00095309 predicted 903
3 SASI_Hs01_00095310 predicted 1278
4 SASI_Hs01_00095311 predicted 2126
5 SASI_Hs02_00303489 predicted 1856
6 SASI_Hs01_00095312 predicted 1844
7 SASI_Hs01_00095313 predicted 1292
8 SASI_Hs01_00095314 predicted 1233
9 SASI_Hs01_00095315 predicted 1295
10 SASI_Hs01_00095316 predicted 1215
11 SASI_Hs01_00095317 predicted 1776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092504 predicted 770
2 SASI_Rn01_00092505 predicted 322
3 SASI_Rn01_00092507 predicted 618
4 SASI_Rn02_00260371 predicted 355
5 SASI_Rn01_00092509 predicted 326
6 SASI_Rn02_00260372 predicted 837
7 SASI_Rn01_00092511 predicted 882
8 SASI_Rn02_00260373 predicted 857
9 SASI_Rn01_00092512 predicted 909
10 SASI_Rn02_00260374 predicted 923
11 SASI_Rn01_00092506 predicted 918
12 SASI_Rn01_00092508 predicted 659
13 SASI_Rn01_00092510 predicted 247
14 SASI_Rn01_00092513 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295641 predicted 920
2 SASI_Mm02_00295642 predicted 1263
3 SASI_Mm02_00295643 predicted 784
4 SASI_Mm02_00295644 predicted 665
5 SASI_Mm02_00295645 predicted 694
6 SASI_Mm02_00295646 predicted 668
7 SASI_Mm02_00295647 predicted 1551
8 SASI_Mm02_00295648 predicted 1402
9 SASI_Mm02_00295649 predicted 1437
10 SASI_Mm02_00295650 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144956 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235021 predicted 878
2 SASI_Mm01_00235022 predicted 925
3 SASI_Mm01_00235023 predicted 1264
4 SASI_Mm01_00235024 predicted 797
5 SASI_Mm01_00235025 predicted 668
6 SASI_Mm01_00235026 predicted 697
7 SASI_Mm01_00235027 predicted 1559
8 SASI_Mm01_00235028 predicted 1414
9 SASI_Mm01_00235029 predicted 1437
10 SASI_Mm01_00235030 predicted 1252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000916
OXTR MISSION shRNA Bacterial Glycerol Stock
oxytocin receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-1599s1c1
Sequence:CCGGCCTGGATCTACATGCTGTTCACTCGAGTGAACAGCATGTAGATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-838s1c1
Sequence:CCGGGCGCCTCTTCTTCTTCATGAACTCGAGTTCATGAAGAAGAAGAGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-1438s1c1
Sequence:CCGGCACGGTCAAGATGACTTTCATCTCGAGATGAAAGTCATCTTGACCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-1279s1c1
Sequence:CCGGCTACGGCCTTATCAGCTTCAACTCGAGTTGAAGCTGATAAGGCCGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000916.3-2072s21c1
Sequence:CCGGGTAATTTCACTCCAGTATATTCTCGAGAATATACTGGAGTGAAATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000916.3-2232s21c1
Sequence:CCGGTCCTGACCTCAAAGTGTATTTCTCGAGAAATACACTTTGAGGTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000916.3-2862s1c1
Sequence:CCGGGCTGGCTTCTTTACAGAAATTCTCGAGAATTTCTGTAAAGAAGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000916.3-919s21c1
Sequence:CCGGGGACATCACCTTCCGCTTCTACTCGAGTAGAAGCGGAAGGTGATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000916.3-1232s21c1
Sequence:CCGGATCACGCTAGCTGTCTACATCCTCGAGGATGTAGACAGCTAGCGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000916
OXTR MISSION shRNA shRNA Plasmid DNA
oxytocin receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-1599s1c1
Sequence:CCGGCCTGGATCTACATGCTGTTCACTCGAGTGAACAGCATGTAGATCCAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-838s1c1
Sequence:CCGGGCGCCTCTTCTTCTTCATGAACTCGAGTTCATGAAGAAGAAGAGGCGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-1438s1c1
Sequence:CCGGCACGGTCAAGATGACTTTCATCTCGAGATGAAAGTCATCTTGACCGTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-1279s1c1
Sequence:CCGGCTACGGCCTTATCAGCTTCAACTCGAGTTGAAGCTGATAAGGCCGTAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000357883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000916.3-2072s21c1
Sequence:CCGGGTAATTTCACTCCAGTATATTCTCGAGAATATACTGGAGTGAAATTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000367845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000916.3-2232s21c1
Sequence:CCGGTCCTGACCTCAAAGTGTATTTCTCGAGAAATACACTTTGAGGTCAGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000916.3-2862s1c1
Sequence:CCGGGCTGGCTTCTTTACAGAAATTCTCGAGAATTTCTGTAAAGAAGCCAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000357884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000916.3-919s21c1
Sequence:CCGGGGACATCACCTTCCGCTTCTACTCGAGTAGAAGCGGAAGGTGATGTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000357885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000916.3-1232s21c1
Sequence:CCGGATCACGCTAGCTGTCTACATCCTCGAGGATGTAGACAGCTAGCGTGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000916
OXTR MISSION shRNA Lentiviral Transduction Particles
oxytocin receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-1599s1c1
Sequence:CCGGCCTGGATCTACATGCTGTTCACTCGAGTGAACAGCATGTAGATCCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-838s1c1
Sequence:CCGGGCGCCTCTTCTTCTTCATGAACTCGAGTTCATGAAGAAGAAGAGGCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-1438s1c1
Sequence:CCGGCACGGTCAAGATGACTTTCATCTCGAGATGAAAGTCATCTTGACCGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000916.3-1279s1c1
Sequence:CCGGCTACGGCCTTATCAGCTTCAACTCGAGTTGAAGCTGATAAGGCCGTAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000916.3-2072s21c1
Sequence:CCGGGTAATTTCACTCCAGTATATTCTCGAGAATATACTGGAGTGAAATTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000916.3-2232s21c1
Sequence:CCGGTCCTGACCTCAAAGTGTATTTCTCGAGAAATACACTTTGAGGTCAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000916.3-2862s1c1
Sequence:CCGGGCTGGCTTCTTTACAGAAATTCTCGAGAATTTCTGTAAAGAAGCCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000916.3-919s21c1
Sequence:CCGGGGACATCACCTTCCGCTTCTACTCGAGTAGAAGCGGAAGGTGATGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000916.3-1232s21c1
Sequence:CCGGATCACGCTAGCTGTCTACATCCTCGAGGATGTAGACAGCTAGCGTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_144956
OXTR MISSION shRNA Bacterial Glycerol Stock
oxytocin receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-621s1c1
Sequence:CCGGCGTCTACATTGTACCGGTCATCTCGAGATGACCGGTACAATGTAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-972s1c1
Sequence:CCGGCCCATGGATCTACATGCTCTTCTCGAGAAGAGCATGTAGATCCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-864s1c1
Sequence:CCGGGCCTTTCTTCTTCGTGCAGATCTCGAGATCTGCACGAAGAAGAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-135s1c1
Sequence:CCGGCCTGTGTCTCATACTGTTCCTCTCGAGAGGAACAGTATGAGACACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-330s1c1
Sequence:CCGGGCTGTGTCGTCTGGTCAAATACTCGAGTATTTGACCAGACGACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_144956
OXTR MISSION shRNA shRNA Plasmid DNA
oxytocin receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-621s1c1
Sequence:CCGGCGTCTACATTGTACCGGTCATCTCGAGATGACCGGTACAATGTAGACGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-972s1c1
Sequence:CCGGCCCATGGATCTACATGCTCTTCTCGAGAAGAGCATGTAGATCCATGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-864s1c1
Sequence:CCGGGCCTTTCTTCTTCGTGCAGATCTCGAGATCTGCACGAAGAAGAAAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-135s1c1
Sequence:CCGGCCTGTGTCTCATACTGTTCCTCTCGAGAGGAACAGTATGAGACACAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-330s1c1
Sequence:CCGGGCTGTGTCGTCTGGTCAAATACTCGAGTATTTGACCAGACGACACAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_144956
OXTR MISSION shRNA Lentiviral Transduction Particles
oxytocin receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-621s1c1
Sequence:CCGGCGTCTACATTGTACCGGTCATCTCGAGATGACCGGTACAATGTAGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-972s1c1
Sequence:CCGGCCCATGGATCTACATGCTCTTCTCGAGAAGAGCATGTAGATCCATGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-864s1c1
Sequence:CCGGGCCTTTCTTCTTCGTGCAGATCTCGAGATCTGCACGAAGAAGAAAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-135s1c1
Sequence:CCGGCCTGTGTCTCATACTGTTCCTCTCGAGAGGAACAGTATGAGACACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144956.2-330s1c1
Sequence:CCGGGCTGTGTCGTCTGGTCAAATACTCGAGTATTTGACCAGACGACACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)