EMAIL THIS PAGE TO A FRIEND

P2RX1

purinergic receptor P2X, ligand-gated ion channel, 1

53 Gene Product Result for
Synonyms: P2X1
UniProtKB ID: P51575, Q9UK84
Gene ID:
Human(5023) Summary: The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis. [provided by RefSeq, Jun 2013]
Mouse(18436) purinergic receptor P2X, ligand-gated ion channel, 1
Rat(25505) purinergic receptor P2X, ligand-gated ion channel, 1
Zebrafish(387296) purinergic receptor P2X, ligand-gated ion channel, 1
chicken(395190) purinergic receptor P2X, ligand-gated ion channel, 1
cow(514898) purinergic receptor P2X, ligand-gated ion channel, 1
Horse(100060689) purinergic receptor P2X, ligand-gated ion channel, 1
domestic cat(101091060) purinergic receptor P2X, ligand-gated ion channel, 1
dog(491223) purinergic receptor P2X, ligand-gated ion channel, 1
domestic guinea pig(100727772) purinergic receptor P2X, ligand-gated ion channel, 1
Domestic Rabbit(100350587) purinergic receptor P2X, ligand-gated ion channel, 1
naked mole-rat(101722936) purinergic receptor P2X, ligand-gated ion channel, 1
sheep(101101902) purinergic receptor P2X, ligand-gated ion channel, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
M6517 α,β-Methyleneadenosine 5′-triphosphate lithium salt ≥93% (HPLC), solid human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S2671 Suramin sodium salt ≥99% (TLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002558 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002558 Rosetta Predictions human pricing
NM_012997 Rosetta Predictions rat pricing
NM_008771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123890 predicted 902
2 SASI_Hs01_00123891 predicted 737
3 SASI_Hs01_00123892 predicted 877
4 SASI_Hs01_00123893 predicted 521
5 SASI_Hs01_00123894 predicted 494
6 SASI_Hs01_00123895 predicted 1015
7 SASI_Hs01_00123896 predicted 1649
8 SASI_Hs01_00123897 predicted 1339
9 SASI_Hs01_00123898 predicted 760
10 SASI_Hs01_00123899 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103490 predicted 819
2 SASI_Rn01_00103491 predicted 608
3 SASI_Rn01_00103492 predicted 533
4 SASI_Rn01_00103493 predicted 618
5 SASI_Rn01_00103494 predicted 892
6 SASI_Rn01_00103495 predicted 962
7 SASI_Rn02_00260647 predicted 661
8 SASI_Rn01_00103496 predicted 876
9 SASI_Rn01_00103497 predicted 272
10 SASI_Rn01_00103498 predicted 844
11 SASI_Rn01_00103499 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174170 predicted 1199
2 SASI_Mm01_00174171 predicted 1143
3 SASI_Mm01_00174172 predicted 580
4 SASI_Mm01_00174173 predicted 632
5 SASI_Mm01_00174174 predicted 848
6 SASI_Mm01_00174175 predicted 789
7 SASI_Mm01_00174176 predicted 358
8 SASI_Mm01_00174177 predicted 628
9 SASI_Mm01_00174178 predicted 1213
10 SASI_Mm01_00174179 predicted 594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002558
P2RX1 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002558.2-1017s21c1
Sequence:CCGGCATCAGCTTTCCACGCTTCAACTCGAGTTGAAGCGTGGAAAGCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002558.2-908s21c1
Sequence:CCGGTGAAGACGTGTGAGATCTTTGCTCGAGCAAAGATCTCACACGTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-1354s1c1
Sequence:CCGGCGTCACCTCTTCAAGGTGTTTCTCGAGAAACACCTTGAAGAGGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-741s1c1
Sequence:CCGGCGTGGTCATGACCAATTTCATCTCGAGATGAAATTGGTCATGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-1521s1c1
Sequence:CCGGGCACTACTACAAGCAGAAGAACTCGAGTTCTTCTGCTTGTAGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-514s1c1
Sequence:CCGGCGTAATAAGAAGGTGGGCGTTCTCGAGAACGCCCACCTTCTTATTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-1270s1c1
Sequence:CCGGCATGGGCTGTACGAAGAGAAACTCGAGTTTCTCTTCGTACAGCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002558.2-2009s21c1
Sequence:CCGGGTAACCATAGGTGACTAAATTCTCGAGAATTTAGTCACCTATGGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002558
P2RX1 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002558.2-1017s21c1
Sequence:CCGGCATCAGCTTTCCACGCTTCAACTCGAGTTGAAGCGTGGAAAGCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002558.2-908s21c1
Sequence:CCGGTGAAGACGTGTGAGATCTTTGCTCGAGCAAAGATCTCACACGTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-1354s1c1
Sequence:CCGGCGTCACCTCTTCAAGGTGTTTCTCGAGAAACACCTTGAAGAGGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-741s1c1
Sequence:CCGGCGTGGTCATGACCAATTTCATCTCGAGATGAAATTGGTCATGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-1521s1c1
Sequence:CCGGGCACTACTACAAGCAGAAGAACTCGAGTTCTTCTGCTTGTAGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-514s1c1
Sequence:CCGGCGTAATAAGAAGGTGGGCGTTCTCGAGAACGCCCACCTTCTTATTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-1270s1c1
Sequence:CCGGCATGGGCTGTACGAAGAGAAACTCGAGTTTCTCTTCGTACAGCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002558.2-2009s21c1
Sequence:CCGGGTAACCATAGGTGACTAAATTCTCGAGAATTTAGTCACCTATGGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002558
P2RX1 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002558.2-1017s21c1
Sequence:CCGGCATCAGCTTTCCACGCTTCAACTCGAGTTGAAGCGTGGAAAGCTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002558.2-908s21c1
Sequence:CCGGTGAAGACGTGTGAGATCTTTGCTCGAGCAAAGATCTCACACGTCTTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-1354s1c1
Sequence:CCGGCGTCACCTCTTCAAGGTGTTTCTCGAGAAACACCTTGAAGAGGTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-741s1c1
Sequence:CCGGCGTGGTCATGACCAATTTCATCTCGAGATGAAATTGGTCATGACCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-1521s1c1
Sequence:CCGGGCACTACTACAAGCAGAAGAACTCGAGTTCTTCTGCTTGTAGTAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-514s1c1
Sequence:CCGGCGTAATAAGAAGGTGGGCGTTCTCGAGAACGCCCACCTTCTTATTACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002558.2-1270s1c1
Sequence:CCGGCATGGGCTGTACGAAGAGAAACTCGAGTTTCTCTTCGTACAGCCCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002558.2-2009s21c1
Sequence:CCGGGTAACCATAGGTGACTAAATTCTCGAGAATTTAGTCACCTATGGTTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008771
P2RX1 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-480s1c1
Sequence:CCGGCCTTTGTAGTTATGACCAATTCTCGAGAATTGGTCATAACTACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-349s1c1
Sequence:CCGGCCAGACCTCAAGTGGCCTTATCTCGAGATAAGGCCACTTGAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-1043s1c1
Sequence:CCGGCCAGGCTTCAACTTCAGATTTCTCGAGAAATCTGAAGTTGAAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-634s1c1
Sequence:CCGGGCCCTTCAATGGCACTGTGAACTCGAGTTCACAGTGCCATTGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-212s1c1
Sequence:CCGGTCAGCCTTCTTCTTTGAGTATCTCGAGATACTCAAAGAAGAAGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008771
P2RX1 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-480s1c1
Sequence:CCGGCCTTTGTAGTTATGACCAATTCTCGAGAATTGGTCATAACTACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-349s1c1
Sequence:CCGGCCAGACCTCAAGTGGCCTTATCTCGAGATAAGGCCACTTGAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-1043s1c1
Sequence:CCGGCCAGGCTTCAACTTCAGATTTCTCGAGAAATCTGAAGTTGAAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-634s1c1
Sequence:CCGGGCCCTTCAATGGCACTGTGAACTCGAGTTCACAGTGCCATTGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-212s1c1
Sequence:CCGGTCAGCCTTCTTCTTTGAGTATCTCGAGATACTCAAAGAAGAAGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008771
P2RX1 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-480s1c1
Sequence:CCGGCCTTTGTAGTTATGACCAATTCTCGAGAATTGGTCATAACTACAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-349s1c1
Sequence:CCGGCCAGACCTCAAGTGGCCTTATCTCGAGATAAGGCCACTTGAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-1043s1c1
Sequence:CCGGCCAGGCTTCAACTTCAGATTTCTCGAGAAATCTGAAGTTGAAGCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-634s1c1
Sequence:CCGGGCCCTTCAATGGCACTGTGAACTCGAGTTCACAGTGCCATTGAAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008771.2-212s1c1
Sequence:CCGGTCAGCCTTCTTCTTTGAGTATCTCGAGATACTCAAAGAAGAAGGCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)