EMAIL THIS PAGE TO A FRIEND

P2RX3

purinergic receptor P2X, ligand-gated ion channel, 3

46 Gene Product Result for
Synonyms: P2X3
UniProtKB ID: P56373, Q6DK37, Q9UQB6
Gene ID:
Human(5024) Summary: The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and may transduce ATP-evoked nociceptor activation. Mouse studies suggest that this receptor is important for peripheral pain responses, and also participates in pathways controlling urinary bladder volume reflexes. It is possible that the development of selective antagonists for this receptor may have a therapeutic potential in pain relief and in the treatment of disorders of urine storage. [provided by RefSeq, Jul 2008]
Mouse(228139) purinergic receptor P2X, ligand-gated ion channel, 3
Rat(81739) purinergic receptor P2X, ligand-gated ion channel, 3
chicken(428856) purinergic receptor P2X, ligand-gated ion channel, 3
cow(530468) purinergic receptor P2X, ligand-gated ion channel, 3
dog(448782) purinergic receptor P2X, ligand-gated ion channel, 3
domestic guinea pig(100722959) purinergic receptor P2X, ligand-gated ion channel, 3
naked mole-rat(101709018) purinergic receptor P2X, ligand-gated ion channel, 3
sheep(101104779) purinergic receptor P2X, ligand-gated ion channel, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002559 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002559 Rosetta Predictions human pricing
NM_031075 Rosetta Predictions rat pricing
NM_145526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174936 predicted 860
2 SASI_Hs01_00174937 predicted 405
3 SASI_Hs01_00174938 predicted 270
4 SASI_Hs01_00174939 predicted 285
5 SASI_Hs01_00174940 predicted 295
6 SASI_Hs01_00174942 predicted 542
7 SASI_Hs02_00334048 predicted 404
8 SASI_Hs01_00174943 predicted 1040
9 SASI_Hs01_00174944 predicted 950
10 SASI_Hs02_00334049 predicted 384
11 SASI_Hs01_00174941 predicted 405
12 SASI_Hs01_00174945 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105098 predicted 1265
2 SASI_Rn01_00105099 predicted 661
3 SASI_Rn01_00105100 predicted 1421
4 SASI_Rn01_00105101 predicted 393
5 SASI_Rn01_00105102 predicted 1192
6 SASI_Rn01_00105103 predicted 1412
7 SASI_Rn02_00264317 predicted 1453
8 SASI_Rn01_00105104 predicted 1190
9 SASI_Rn01_00105105 predicted 1351
10 SASI_Rn01_00105106 predicted 514
11 SASI_Rn01_00105107 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060927 predicted 1619
2 SASI_Mm01_00060928 predicted 707
3 SASI_Mm01_00060929 predicted 1019
4 SASI_Mm01_00060930 predicted 1247
5 SASI_Mm01_00060931 predicted 743
6 SASI_Mm01_00060932 predicted 1548
7 SASI_Mm01_00060933 predicted 865
8 SASI_Mm01_00060934 predicted 1703
9 SASI_Mm01_00060935 predicted 1768
10 SASI_Mm01_00060936 predicted 697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002559
P2RX3 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002559.2-993s21c1
Sequence:CCGGACGTGCTGGTATACGGGAATGCTCGAGCATTCCCGTATACCAGCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002559.2-552s21c1
Sequence:CCGGCAGTGGAAACGCCCATCATGACTCGAGTCATGATGGGCGTTTCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-157s1c1
Sequence:CCGGCCGAGTAGTTCAGCTTCTGATCTCGAGATCAGAAGCTGAACTACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-625s1c1
Sequence:CCGGCTTCAACTTTGAGAAGGGAAACTCGAGTTTCCCTTCTCAAAGTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-1126s1c1
Sequence:CCGGCGACCAGTACAAAGCCAAGAACTCGAGTTCTTGGCTTTGTACTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-183s1c1
Sequence:CCGGCCTACTTTGTAGGGTGGGTTTCTCGAGAAACCCACCCTACAAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-294s1c1
Sequence:CCGGGAGTCATGGATGTGTCTGATTCTCGAGAATCAGACACATCCATGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002559
P2RX3 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002559.2-993s21c1
Sequence:CCGGACGTGCTGGTATACGGGAATGCTCGAGCATTCCCGTATACCAGCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002559.2-552s21c1
Sequence:CCGGCAGTGGAAACGCCCATCATGACTCGAGTCATGATGGGCGTTTCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-157s1c1
Sequence:CCGGCCGAGTAGTTCAGCTTCTGATCTCGAGATCAGAAGCTGAACTACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-625s1c1
Sequence:CCGGCTTCAACTTTGAGAAGGGAAACTCGAGTTTCCCTTCTCAAAGTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-1126s1c1
Sequence:CCGGCGACCAGTACAAAGCCAAGAACTCGAGTTCTTGGCTTTGTACTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-183s1c1
Sequence:CCGGCCTACTTTGTAGGGTGGGTTTCTCGAGAAACCCACCCTACAAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-294s1c1
Sequence:CCGGGAGTCATGGATGTGTCTGATTCTCGAGAATCAGACACATCCATGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002559
P2RX3 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002559.2-993s21c1
Sequence:CCGGACGTGCTGGTATACGGGAATGCTCGAGCATTCCCGTATACCAGCACGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002559.2-552s21c1
Sequence:CCGGCAGTGGAAACGCCCATCATGACTCGAGTCATGATGGGCGTTTCCACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-157s1c1
Sequence:CCGGCCGAGTAGTTCAGCTTCTGATCTCGAGATCAGAAGCTGAACTACTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-625s1c1
Sequence:CCGGCTTCAACTTTGAGAAGGGAAACTCGAGTTTCCCTTCTCAAAGTTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-1126s1c1
Sequence:CCGGCGACCAGTACAAAGCCAAGAACTCGAGTTCTTGGCTTTGTACTGGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-183s1c1
Sequence:CCGGCCTACTTTGTAGGGTGGGTTTCTCGAGAAACCCACCCTACAAAGTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002559.2-294s1c1
Sequence:CCGGGAGTCATGGATGTGTCTGATTCTCGAGAATCAGACACATCCATGACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145526
P2RX3 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-281s1c1
Sequence:CCGGGCTGCTGATTATCTCCTACTTCTCGAGAAGTAGGAGATAATCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-361s1c1
Sequence:CCGGCCTCAGTAGTAACAAAGGTAACTCGAGTTACCTTTGTTACTACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-770s1c1
Sequence:CCGGCCTCACCGACAAGGACATAAACTCGAGTTTATGTCCTTGTCGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-497s1c1
Sequence:CCGGGCAAGGATTCTGTCCAGAGAACTCGAGTTCTCTGGACAGAATCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-1125s1c1
Sequence:CCGGGCTGGCAAGTTCAACATCATTCTCGAGAATGATGTTGAACTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145526
P2RX3 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-281s1c1
Sequence:CCGGGCTGCTGATTATCTCCTACTTCTCGAGAAGTAGGAGATAATCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-361s1c1
Sequence:CCGGCCTCAGTAGTAACAAAGGTAACTCGAGTTACCTTTGTTACTACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-770s1c1
Sequence:CCGGCCTCACCGACAAGGACATAAACTCGAGTTTATGTCCTTGTCGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-497s1c1
Sequence:CCGGGCAAGGATTCTGTCCAGAGAACTCGAGTTCTCTGGACAGAATCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-1125s1c1
Sequence:CCGGGCTGGCAAGTTCAACATCATTCTCGAGAATGATGTTGAACTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145526
P2RX3 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-281s1c1
Sequence:CCGGGCTGCTGATTATCTCCTACTTCTCGAGAAGTAGGAGATAATCAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-361s1c1
Sequence:CCGGCCTCAGTAGTAACAAAGGTAACTCGAGTTACCTTTGTTACTACTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-770s1c1
Sequence:CCGGCCTCACCGACAAGGACATAAACTCGAGTTTATGTCCTTGTCGGTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-497s1c1
Sequence:CCGGGCAAGGATTCTGTCCAGAGAACTCGAGTTCTCTGGACAGAATCCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145526.1-1125s1c1
Sequence:CCGGGCTGGCAAGTTCAACATCATTCTCGAGAATGATGTTGAACTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)