EMAIL THIS PAGE TO A FRIEND

P2RX4

purinergic receptor P2X, ligand-gated ion channel, 4

59 Gene Product Result for
Synonyms: P2X4 P2X4R
UniProtKB ID: Q99571, O00450, O14722, Q5U090, Q8N4N1, Q9UBG9
Gene ID:
Human(5025) Summary: The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(18438) purinergic receptor P2X, ligand-gated ion channel 4
Rat(29659) purinergic receptor P2X, ligand-gated ion channel 4
chicken(374166) purinergic receptor P2X, ligand-gated ion channel, 4
dog(448783) purinergic receptor P2X, ligand-gated ion channel, 4
domestic cat(101080484) purinergic receptor P2X, ligand-gated ion channel, 4
Horse(100059626) purinergic receptor P2X, ligand-gated ion channel, 4
cow(338036) purinergic receptor P2X, ligand-gated ion channel, 4
sheep(101104013) purinergic receptor P2X, ligand-gated ion channel, 4
naked mole-rat(101723201) purinergic receptor P2X, ligand-gated ion channel, 4
domestic guinea pig(100716323) purinergic receptor P2X, ligand-gated ion channel, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002560 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002560 Rosetta Predictions human pricing
NM_031594 Rosetta Predictions rat pricing
NM_011026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062695 predicted 1527
2 SASI_Hs01_00062696 predicted 1567
3 SASI_Hs01_00062697 predicted 1230
4 SASI_Hs01_00062699 predicted 1162
5 SASI_Hs01_00062700 predicted 567
6 SASI_Hs01_00062701 predicted 1668
7 SASI_Hs02_00334050 predicted 1393
8 SASI_Hs01_00062702 predicted 1404
9 SASI_Hs01_00062703 predicted 755
10 SASI_Hs01_00062704 predicted 655
11 SASI_Hs01_00062698 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064190 predicted 460
2 SASI_Rn02_00264866 predicted 1194
3 SASI_Rn01_00064191 predicted 735
4 SASI_Rn01_00064193 predicted 551
5 SASI_Rn01_00064194 predicted 782
6 SASI_Rn01_00064195 predicted 536
7 SASI_Rn01_00064196 predicted 953
8 SASI_Rn01_00064197 predicted 862
9 SASI_Rn01_00064198 predicted 406
10 SASI_Rn02_00264867 predicted 882
11 SASI_Rn01_00064189 predicted 1182
12 SASI_Rn01_00064192 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168284 predicted 1046
2 SASI_Mm01_00168285 predicted 855
3 SASI_Mm01_00168286 predicted 731
4 SASI_Mm01_00168287 predicted 1166
5 SASI_Mm01_00168293 predicted 600
6 SASI_Mm01_00168288 predicted 396
7 SASI_Mm01_00168290 predicted 1028
8 SASI_Mm01_00168291 predicted 777
9 SASI_Mm01_00168292 predicted 468
10 SASI_Mm02_00319750 predicted 518
11 SASI_Mm01_00168289 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011026
VALIDATED
P2RX4 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-585s1c1
Sequence:CCGGCCTACCTCAAGTCGTGCATTTCTCGAGAAATGCACGACTTGAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011026.1-385s1c1
Sequence:CCGGGATTCCTGATAAGACCAGCATCTCGAGATGCTGGTCTTATCAGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-959s21c1
Sequence:CCGGGTGTCTCCTGGCTACAATTTCCTCGAGGAAATTGTAGCCAGGAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-451s21c1
Sequence:CCGGGATTCCTGATAAGACCAGCATCTCGAGATGCTGGTCTTATCAGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-1611s21c1
Sequence:CCGGACATCCAAGAAACCCTATTAACTCGAGTTAATAGGGTTTCTTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-902s1c1
Sequence:CCGGCGCTTTGACATCATCGTGTTTCTCGAGAAACACGATGATGTCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-1027s1c1
Sequence:CCGGCTGTATGAAGAAGAGATACTACTCGAGTAGTATCTCTTCTTCATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-1052s1c1
Sequence:CCGGCGGGACAAGAAATATAAGTATCTCGAGATACTTATATTTCTTGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-1174s21c1
Sequence:CCGGCTGTATGAAGAAGAGATACTACTCGAGTAGTATCTCTTCTTCATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-1261s21c1
Sequence:CCGGGTGATGCCTAACCCTACATTTCTCGAGAAATGTAGGGTTAGGCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011026
VALIDATED
P2RX4 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-585s1c1
Sequence:CCGGCCTACCTCAAGTCGTGCATTTCTCGAGAAATGCACGACTTGAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011026.1-385s1c1
Sequence:CCGGGATTCCTGATAAGACCAGCATCTCGAGATGCTGGTCTTATCAGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-959s21c1
Sequence:CCGGGTGTCTCCTGGCTACAATTTCCTCGAGGAAATTGTAGCCAGGAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-451s21c1
Sequence:CCGGGATTCCTGATAAGACCAGCATCTCGAGATGCTGGTCTTATCAGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-1611s21c1
Sequence:CCGGACATCCAAGAAACCCTATTAACTCGAGTTAATAGGGTTTCTTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-902s1c1
Sequence:CCGGCGCTTTGACATCATCGTGTTTCTCGAGAAACACGATGATGTCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-1027s1c1
Sequence:CCGGCTGTATGAAGAAGAGATACTACTCGAGTAGTATCTCTTCTTCATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-1052s1c1
Sequence:CCGGCGGGACAAGAAATATAAGTATCTCGAGATACTTATATTTCTTGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-1174s21c1
Sequence:CCGGCTGTATGAAGAAGAGATACTACTCGAGTAGTATCTCTTCTTCATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-1261s21c1
Sequence:CCGGGTGATGCCTAACCCTACATTTCTCGAGAAATGTAGGGTTAGGCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011026
VALIDATED
P2RX4 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-585s1c1
Sequence:CCGGCCTACCTCAAGTCGTGCATTTCTCGAGAAATGCACGACTTGAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011026.1-385s1c1
Sequence:CCGGGATTCCTGATAAGACCAGCATCTCGAGATGCTGGTCTTATCAGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-959s21c1
Sequence:CCGGGTGTCTCCTGGCTACAATTTCCTCGAGGAAATTGTAGCCAGGAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-451s21c1
Sequence:CCGGGATTCCTGATAAGACCAGCATCTCGAGATGCTGGTCTTATCAGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-1611s21c1
Sequence:CCGGACATCCAAGAAACCCTATTAACTCGAGTTAATAGGGTTTCTTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-902s1c1
Sequence:CCGGCGCTTTGACATCATCGTGTTTCTCGAGAAACACGATGATGTCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-1027s1c1
Sequence:CCGGCTGTATGAAGAAGAGATACTACTCGAGTAGTATCTCTTCTTCATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011026.1-1052s1c1
Sequence:CCGGCGGGACAAGAAATATAAGTATCTCGAGATACTTATATTTCTTGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-1174s21c1
Sequence:CCGGCTGTATGAAGAAGAGATACTACTCGAGTAGTATCTCTTCTTCATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011026.2-1261s21c1
Sequence:CCGGGTGATGCCTAACCCTACATTTCTCGAGAAATGTAGGGTTAGGCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002560
VALIDATED
P2RX4 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002560.2-1430s21c1
Sequence:CCGGGAAGATTACGAGCAGGGTCTTCTCGAGAAGACCCTGCTCGTAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002560.2-563s1c1
Sequence:CCGGGCGGATTATGTGATACCAGCTCTCGAGAGCTGGTATCACATAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002560.2-1256s1c1
Sequence:CCGGCGCTTCGACATCATTGTGTTTCTCGAGAAACACAATGATGTCGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002560.2-949s1c1
Sequence:CCGGGTCGTGCATTTATGATGCTAACTCGAGTTAGCATCATAAATGCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002560.2-1430s1c1
Sequence:CCGGGAAGATTACGAGCAGGGTCTTCTCGAGAAGACCCTGCTCGTAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002560.2-1625s21c1
Sequence:CCGGGTTGTGTGCAGGATCTGTTTGCTCGAGCAAACAGATCCTGCACACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002560.2-563s21c1
Sequence:CCGGGCGGATTATGTGATACCAGCTCTCGAGAGCTGGTATCACATAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_002560.2-949s21c1
Sequence:CCGGGTCGTGCATTTATGATGCTAACTCGAGTTAGCATCATAAATGCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002560.2-1165s21c1
Sequence:CCGGCGTATCTCCTGGCTACAATTTCTCGAGAAATTGTAGCCAGGAGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002560
VALIDATED
P2RX4 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002560.2-1430s21c1
Sequence:CCGGGAAGATTACGAGCAGGGTCTTCTCGAGAAGACCCTGCTCGTAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002560.2-563s1c1
Sequence:CCGGGCGGATTATGTGATACCAGCTCTCGAGAGCTGGTATCACATAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002560.2-1256s1c1
Sequence:CCGGCGCTTCGACATCATTGTGTTTCTCGAGAAACACAATGATGTCGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002560.2-949s1c1
Sequence:CCGGGTCGTGCATTTATGATGCTAACTCGAGTTAGCATCATAAATGCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002560.2-1430s1c1
Sequence:CCGGGAAGATTACGAGCAGGGTCTTCTCGAGAAGACCCTGCTCGTAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002560.2-1625s21c1
Sequence:CCGGGTTGTGTGCAGGATCTGTTTGCTCGAGCAAACAGATCCTGCACACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002560.2-563s21c1
Sequence:CCGGGCGGATTATGTGATACCAGCTCTCGAGAGCTGGTATCACATAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_002560.2-949s21c1
Sequence:CCGGGTCGTGCATTTATGATGCTAACTCGAGTTAGCATCATAAATGCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002560.2-1165s21c1
Sequence:CCGGCGTATCTCCTGGCTACAATTTCTCGAGAAATTGTAGCCAGGAGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002560
VALIDATED
P2RX4 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002560.2-1430s21c1
Sequence:CCGGGAAGATTACGAGCAGGGTCTTCTCGAGAAGACCCTGCTCGTAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002560.2-563s1c1
Sequence:CCGGGCGGATTATGTGATACCAGCTCTCGAGAGCTGGTATCACATAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002560.2-1256s1c1
Sequence:CCGGCGCTTCGACATCATTGTGTTTCTCGAGAAACACAATGATGTCGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002560.2-949s1c1
Sequence:CCGGGTCGTGCATTTATGATGCTAACTCGAGTTAGCATCATAAATGCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002560.2-1430s1c1
Sequence:CCGGGAAGATTACGAGCAGGGTCTTCTCGAGAAGACCCTGCTCGTAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002560.2-1625s21c1
Sequence:CCGGGTTGTGTGCAGGATCTGTTTGCTCGAGCAAACAGATCCTGCACACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002560.2-563s21c1
Sequence:CCGGGCGGATTATGTGATACCAGCTCTCGAGAGCTGGTATCACATAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_002560.2-949s21c1
Sequence:CCGGGTCGTGCATTTATGATGCTAACTCGAGTTAGCATCATAAATGCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002560.2-1165s21c1
Sequence:CCGGCGTATCTCCTGGCTACAATTTCTCGAGAAATTGTAGCCAGGAGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)