EMAIL THIS PAGE TO A FRIEND

P2RX5

purinergic receptor P2X, ligand-gated ion channel, 5

89 Gene Product Result for
Synonyms: LRH-1 P2X5 P2X5R
Gene ID:
Human(5026) Summary: The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]
Mouse(94045) purinergic receptor P2X, ligand-gated ion channel, 5
Rat(113995) purinergic receptor P2X, ligand-gated ion channel, 5
Zebrafish(373879) purinergic receptor P2X, ligand-gated ion channel, 5
chicken(395507) purinergic receptor P2X, ligand-gated ion channel, 5
dog(448785) purinergic receptor P2X, ligand-gated ion channel, 5
cow(338035) purinergic receptor P2X, ligand-gated ion channel, 5
domestic cat(101080493) purinergic receptor P2X, ligand-gated ion channel, 5
domestic guinea pig(100731287) purinergic receptor P2X, ligand-gated ion channel, 5
naked mole-rat(101725587) purinergic receptor P2X, ligand-gated ion channel, 5
sheep(101110429) purinergic receptor P2X, ligand-gated ion channel, 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002561 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002561 Rosetta Predictions human pricing
NM_175080 Rosetta Predictions human pricing
NM_175081 Rosetta Predictions human pricing
NM_080780 Rosetta Predictions rat pricing
NM_033321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087100 predicted 336
2 SASI_Hs01_00087101 predicted 339
3 SASI_Hs01_00087102 predicted 338
4 SASI_Hs01_00087103 predicted 339
5 SASI_Hs01_00087104 predicted 340
6 SASI_Hs01_00087105 predicted 336
7 SASI_Hs01_00087106 predicted 412
8 SASI_Hs01_00087107 predicted 699
9 SASI_Hs02_00334051 predicted 1557
10 SASI_Hs02_00334052 predicted 1231
11 SASI_Hs01_00087108 predicted 1048
12 SASI_Hs01_00087109 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135439 predicted 342
2 SASI_Hs01_00135440 predicted 343
3 SASI_Hs01_00135441 predicted 341
4 SASI_Hs01_00135442 predicted 338
5 SASI_Hs01_00135443 predicted 341
6 SASI_Hs01_00135444 predicted 343
7 SASI_Hs01_00135445 predicted 821
8 SASI_Hs01_00135446 predicted 409
9 SASI_Hs01_00135447 predicted 622
10 SASI_Hs02_00368989 predicted 1476
11 SASI_Hs01_00135448 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204758 predicted 343
2 SASI_Hs01_00204759 predicted 340
3 SASI_Hs01_00204760 predicted 333
4 SASI_Hs01_00204761 predicted 338
5 SASI_Hs01_00204762 predicted 336
6 SASI_Hs01_00204763 predicted 337
7 SASI_Hs02_00368990 predicted 454
8 SASI_Hs01_00204764 predicted 409
9 SASI_Hs01_00204765 predicted 698
10 SASI_Hs01_00204766 predicted 628
11 SASI_Hs01_00204767 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079628 predicted 308
2 SASI_Rn01_00079629 predicted 803
3 SASI_Rn01_00079630 predicted 1310
4 SASI_Rn01_00079631 predicted 316
5 SASI_Rn01_00079632 predicted 689
6 SASI_Rn01_00079633 predicted 1560
7 SASI_Rn01_00079635 predicted 1079
8 SASI_Rn01_00079636 predicted 1572
9 SASI_Rn01_00079637 predicted 1076
10 SASI_Rn02_00267300 predicted 330
11 SASI_Rn01_00079634 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104961 predicted 198
2 SASI_Mm01_00104962 predicted 578
3 SASI_Mm01_00104963 predicted 925
4 SASI_Mm01_00104964 predicted 224
5 SASI_Mm01_00104965 predicted 693
6 SASI_Mm01_00104966 predicted 1016
7 SASI_Mm01_00104967 predicted 966
8 SASI_Mm01_00104968 predicted 1003
9 SASI_Mm01_00104969 predicted 586
10 SASI_Mm01_00104970 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002561
VALIDATED
P2RX5 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 5
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-1256s21c1
Sequence:CCGGGAACGGCAAGGGTGCTTTCTTCTCGAGAAGAAAGCACCCTTGCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002561.2-1634s21c1
Sequence:CCGGGATGCTGCCCAACGGGAAATTCTCGAGAATTTCCCGTTGGGCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-1038s21c1
Sequence:CCGGGGTGGCGTGATAGGAATTAATCTCGAGATTAATTCCTATCACGCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002561.2-1817s21c1
Sequence:CCGGCACTAGGGAACGGGTTGTAAACTCGAGTTTACAACCCGTTCCCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-707s21c1
Sequence:CCGGTACAGCTGGAAACGGAGTGAACTCGAGTTCACTCCGTTTCCAGCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002561.2-1323s1c1
Sequence:CCGGCGTGACAAGAAGTACGAGGAACTCGAGTTCCTCGTACTTCTTGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002561.2-428s1c1
Sequence:CCGGGTTCCTGATAAAGAAGGGTTACTCGAGTAACCCTTCTTTATCAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002561.2-1155s1c1
Sequence:CCGGTCCGGGTACAACTTCAGATTTCTCGAGAAATCTGAAGTTGTACCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002561.2-1123s1c1
Sequence:CCGGGTCTGGACAATAAACTTTCAACTCGAGTTGAAAGTTTATTGTCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-1064s21c1
Sequence:CCGGATGGAACTGTGATCTTGATAACTCGAGTTATCAAGATCACAGTTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002561.2-338s1c1
Sequence:CCGGCGAGAAGTATGTCATCGCCAACTCGAGTTGGCGATGACATACTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-631s21c1
Sequence:CCGGACGTCTGTGCTGAGAATGAAGCTCGAGCTTCATTCTCAGCACAGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-858s21c1
Sequence:CCGGATAAAGAACCACATCCGTTTCCTCGAGGAAACGGATGTGGTTCTTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-544s21c1
Sequence:CCGGATGTCGCCGACTACGTCATTCCTCGAGGAATGACGTAGTCGGCGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002561
VALIDATED
P2RX5 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 5
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-1256s21c1
Sequence:CCGGGAACGGCAAGGGTGCTTTCTTCTCGAGAAGAAAGCACCCTTGCCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002561.2-1634s21c1
Sequence:CCGGGATGCTGCCCAACGGGAAATTCTCGAGAATTTCCCGTTGGGCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-1038s21c1
Sequence:CCGGGGTGGCGTGATAGGAATTAATCTCGAGATTAATTCCTATCACGCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002561.2-1817s21c1
Sequence:CCGGCACTAGGGAACGGGTTGTAAACTCGAGTTTACAACCCGTTCCCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-707s21c1
Sequence:CCGGTACAGCTGGAAACGGAGTGAACTCGAGTTCACTCCGTTTCCAGCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002561.2-1323s1c1
Sequence:CCGGCGTGACAAGAAGTACGAGGAACTCGAGTTCCTCGTACTTCTTGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002561.2-428s1c1
Sequence:CCGGGTTCCTGATAAAGAAGGGTTACTCGAGTAACCCTTCTTTATCAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002561.2-1155s1c1
Sequence:CCGGTCCGGGTACAACTTCAGATTTCTCGAGAAATCTGAAGTTGTACCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002561.2-1123s1c1
Sequence:CCGGGTCTGGACAATAAACTTTCAACTCGAGTTGAAAGTTTATTGTCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-1064s21c1
Sequence:CCGGATGGAACTGTGATCTTGATAACTCGAGTTATCAAGATCACAGTTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002561.2-338s1c1
Sequence:CCGGCGAGAAGTATGTCATCGCCAACTCGAGTTGGCGATGACATACTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-631s21c1
Sequence:CCGGACGTCTGTGCTGAGAATGAAGCTCGAGCTTCATTCTCAGCACAGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-858s21c1
Sequence:CCGGATAAAGAACCACATCCGTTTCCTCGAGGAAACGGATGTGGTTCTTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-544s21c1
Sequence:CCGGATGTCGCCGACTACGTCATTCCTCGAGGAATGACGTAGTCGGCGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002561
VALIDATED
P2RX5 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 5
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-1256s21c1
Sequence:CCGGGAACGGCAAGGGTGCTTTCTTCTCGAGAAGAAAGCACCCTTGCCGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002561.2-1634s21c1
Sequence:CCGGGATGCTGCCCAACGGGAAATTCTCGAGAATTTCCCGTTGGGCAGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-1038s21c1
Sequence:CCGGGGTGGCGTGATAGGAATTAATCTCGAGATTAATTCCTATCACGCCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002561.2-1817s21c1
Sequence:CCGGCACTAGGGAACGGGTTGTAAACTCGAGTTTACAACCCGTTCCCTAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-707s21c1
Sequence:CCGGTACAGCTGGAAACGGAGTGAACTCGAGTTCACTCCGTTTCCAGCTGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002561.2-1323s1c1
Sequence:CCGGCGTGACAAGAAGTACGAGGAACTCGAGTTCCTCGTACTTCTTGTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002561.2-428s1c1
Sequence:CCGGGTTCCTGATAAAGAAGGGTTACTCGAGTAACCCTTCTTTATCAGGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002561.2-1155s1c1
Sequence:CCGGTCCGGGTACAACTTCAGATTTCTCGAGAAATCTGAAGTTGTACCCGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002561.2-1123s1c1
Sequence:CCGGGTCTGGACAATAAACTTTCAACTCGAGTTGAAAGTTTATTGTCCAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-1064s21c1
Sequence:CCGGATGGAACTGTGATCTTGATAACTCGAGTTATCAAGATCACAGTTCCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002561.2-338s1c1
Sequence:CCGGCGAGAAGTATGTCATCGCCAACTCGAGTTGGCGATGACATACTTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-631s21c1
Sequence:CCGGACGTCTGTGCTGAGAATGAAGCTCGAGCTTCATTCTCAGCACAGACGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-858s21c1
Sequence:CCGGATAAAGAACCACATCCGTTTCCTCGAGGAAACGGATGTGGTTCTTTATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002561.2-544s21c1
Sequence:CCGGATGTCGCCGACTACGTCATTCCTCGAGGAATGACGTAGTCGGCGACATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033321
P2RX5 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-1138s1c1
Sequence:CCGGCCTGGTACTTATCTACCTCATCTCGAGATGAGGTAGATAAGTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-883s1c1
Sequence:CCGGCCACTGCAACCCACACTATTACTCGAGTAATAGTGTGGGTTGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-1001s1c1
Sequence:CCGGCGTGACCTGATGAAAGCATATCTCGAGATATGCTTTCATCAGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-184s1c1
Sequence:CCGGGCTCACCATCCTGTTGTACTTCTCGAGAAGTACAACAGGATGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-684s1c1
Sequence:CCGGCCAAAGCCAATGTGCTAGAAACTCGAGTTTCTAGCACATTGGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033321
P2RX5 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-1138s1c1
Sequence:CCGGCCTGGTACTTATCTACCTCATCTCGAGATGAGGTAGATAAGTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-883s1c1
Sequence:CCGGCCACTGCAACCCACACTATTACTCGAGTAATAGTGTGGGTTGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-1001s1c1
Sequence:CCGGCGTGACCTGATGAAAGCATATCTCGAGATATGCTTTCATCAGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-184s1c1
Sequence:CCGGGCTCACCATCCTGTTGTACTTCTCGAGAAGTACAACAGGATGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-684s1c1
Sequence:CCGGCCAAAGCCAATGTGCTAGAAACTCGAGTTTCTAGCACATTGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033321
P2RX5 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-1138s1c1
Sequence:CCGGCCTGGTACTTATCTACCTCATCTCGAGATGAGGTAGATAAGTACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-883s1c1
Sequence:CCGGCCACTGCAACCCACACTATTACTCGAGTAATAGTGTGGGTTGCAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-1001s1c1
Sequence:CCGGCGTGACCTGATGAAAGCATATCTCGAGATATGCTTTCATCAGGTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-184s1c1
Sequence:CCGGGCTCACCATCCTGTTGTACTTCTCGAGAAGTACAACAGGATGGTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033321.1-684s1c1
Sequence:CCGGCCAAAGCCAATGTGCTAGAAACTCGAGTTTCTAGCACATTGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)