EMAIL THIS PAGE TO A FRIEND

P2RX6

purinergic receptor P2X, ligand-gated ion channel, 6

40 Gene Product Result for
Synonyms: P2RXL1 P2X6 P2XM
UniProtKB ID: O15547, F6V3D7, Q32MB6, Q58F04, Q6IC33, Q9UL50
Gene ID:
Human(9127) Summary: The protein encoded by this gene belongs to the family of P2X receptors, which are ATP-gated ion channels and mediate rapid and selective permeability to cations. This gene is predominantly expressed in skeletal muscle, and regulated by p53. The encoded protein is associated with VE-cadherin at the adherens junctions of human umbilical vein endothelial cells. Alternative splicing results in multiple transcript variants. A related pseudogene, which is also located on chromosome 22, has been identified. [provided by RefSeq, Apr 2009]
Mouse(18440) purinergic receptor P2X, ligand-gated ion channel, 6
Rat(25041) purinergic receptor P2X, ligand-gated ion channel, 6
dog(486436) purinergic receptor P2X, ligand-gated ion channel, 6
domestic cat(101083550) purinergic receptor P2X, ligand-gated ion channel, 6
Horse(100051842) purinergic receptor P2X, ligand-gated ion channel, 6
cow(618262) purinergic receptor P2X, ligand-gated ion channel, 6
naked mole-rat(101702346) purinergic receptor P2X, ligand-gated ion channel, 6
domestic guinea pig(100732430) purinergic receptor P2X, ligand-gated ion channel, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056971 MISSION® esiRNA esiRNA human P2RX6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005446 Rosetta Predictions human pricing
NM_012721 Rosetta Predictions rat pricing
NM_011028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169673 predicted 1171
2 SASI_Hs01_00169674 predicted 446
3 SASI_Hs01_00169675 predicted 1139
4 SASI_Hs01_00169676 predicted 1147
5 SASI_Hs01_00169677 predicted 1301
6 SASI_Hs01_00169678 predicted 888
7 SASI_Hs01_00169679 predicted 680
8 SASI_Hs01_00169680 predicted 1492
9 SASI_Hs01_00169681 predicted 796
10 SASI_Hs01_00169682 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100401 predicted 446
2 SASI_Rn01_00100402 predicted 592
3 SASI_Rn01_00100403 predicted 296
4 SASI_Rn01_00100404 predicted 1052
5 SASI_Rn01_00100405 predicted 1129
6 SASI_Rn01_00100406 predicted 677
7 SASI_Rn02_00260058 predicted 256
8 SASI_Rn01_00100407 predicted 438
9 SASI_Rn01_00100408 predicted 865
10 SASI_Rn01_00100410 predicted 945
11 SASI_Rn01_00100409 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034481 predicted 338
2 SASI_Mm01_00034482 predicted 623
3 SASI_Mm01_00034484 predicted 463
4 SASI_Mm02_00319761 predicted 1191
5 SASI_Mm01_00034485 predicted 256
6 SASI_Mm02_00319762 predicted 503
7 SASI_Mm01_00034486 predicted 233
8 SASI_Mm01_00034487 predicted 692
9 SASI_Mm01_00034488 predicted 680
10 SASI_Mm01_00034489 predicted 227
11 SASI_Mm01_00034483 predicted 630
12 SASI_Mm01_00034490 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005446
P2RX6 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-619s21c1
Sequence:CCGGAGCAAGTTCAACTTCTCTAAGCTCGAGCTTAGAGAAGTTGAACTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005446.2-3356s1c1
Sequence:CCGGCCAGCATCTTTGATGTGGATTCTCGAGAATCCACATCAAAGATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-1113s1c1
Sequence:CCGGCCATTTCTACTGGAGGACAAACTCGAGTTTGTCCTCCAGTAGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-339s1c1
Sequence:CCGGCGTGTTCTTCTTGGTGACCAACTCGAGTTGGTCACCAAGAAGAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-1090s1c1
Sequence:CCGGCTGCTGTATGTGGATAGAGAACTCGAGTTCTCTATCCACATACAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-698s1c1
Sequence:CCGGGCCGCTATGAACCACAATTCACTCGAGTGAATTGTGGTTCATAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-450s21c1
Sequence:CCGGCACACACAGCCACGGTGTAAACTCGAGTTTACACCGTGGCTGTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-137s21c1
Sequence:CCGGAGTTTGGGATCGTGGTCTATGCTCGAGCATAGACCACGATCCCAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-68s21c1
Sequence:CCGGTGGATTATAAGACGGAGAAGTCTCGAGACTTCTCCGTCTTATAATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005446
P2RX6 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-619s21c1
Sequence:CCGGAGCAAGTTCAACTTCTCTAAGCTCGAGCTTAGAGAAGTTGAACTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005446.2-3356s1c1
Sequence:CCGGCCAGCATCTTTGATGTGGATTCTCGAGAATCCACATCAAAGATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-1113s1c1
Sequence:CCGGCCATTTCTACTGGAGGACAAACTCGAGTTTGTCCTCCAGTAGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-339s1c1
Sequence:CCGGCGTGTTCTTCTTGGTGACCAACTCGAGTTGGTCACCAAGAAGAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-1090s1c1
Sequence:CCGGCTGCTGTATGTGGATAGAGAACTCGAGTTCTCTATCCACATACAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-698s1c1
Sequence:CCGGGCCGCTATGAACCACAATTCACTCGAGTGAATTGTGGTTCATAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-450s21c1
Sequence:CCGGCACACACAGCCACGGTGTAAACTCGAGTTTACACCGTGGCTGTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-137s21c1
Sequence:CCGGAGTTTGGGATCGTGGTCTATGCTCGAGCATAGACCACGATCCCAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-68s21c1
Sequence:CCGGTGGATTATAAGACGGAGAAGTCTCGAGACTTCTCCGTCTTATAATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005446
P2RX6 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-619s21c1
Sequence:CCGGAGCAAGTTCAACTTCTCTAAGCTCGAGCTTAGAGAAGTTGAACTTGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005446.2-3356s1c1
Sequence:CCGGCCAGCATCTTTGATGTGGATTCTCGAGAATCCACATCAAAGATGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-1113s1c1
Sequence:CCGGCCATTTCTACTGGAGGACAAACTCGAGTTTGTCCTCCAGTAGAAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-339s1c1
Sequence:CCGGCGTGTTCTTCTTGGTGACCAACTCGAGTTGGTCACCAAGAAGAACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-1090s1c1
Sequence:CCGGCTGCTGTATGTGGATAGAGAACTCGAGTTCTCTATCCACATACAGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005446.2-698s1c1
Sequence:CCGGGCCGCTATGAACCACAATTCACTCGAGTGAATTGTGGTTCATAGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-450s21c1
Sequence:CCGGCACACACAGCCACGGTGTAAACTCGAGTTTACACCGTGGCTGTGTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-137s21c1
Sequence:CCGGAGTTTGGGATCGTGGTCTATGCTCGAGCATAGACCACGATCCCAAACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005446.3-68s21c1
Sequence:CCGGTGGATTATAAGACGGAGAAGTCTCGAGACTTCTCCGTCTTATAATCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011028
P2RX6 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011028.1-1331s1c1
Sequence:CCGGGCCTATTCATTCCTGAGGCTTCTCGAGAAGCCTCAGGAATGAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-653s1c1
Sequence:CCGGCTCCAGATCCAATGCCTTATTCTCGAGAATAAGGCATTGGATCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-887s1c1
Sequence:CCGGGCAGCAGAAAGGGTACAACTTCTCGAGAAGTTGTACCCTTTCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-162s1c1
Sequence:CCGGGCAGTGGTAGTCTACGTGATACTCGAGTATCACGTAGACTACCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-87s1c1
Sequence:CCGGCTGGATTACAAGACGGAGAAACTCGAGTTTCTCCGTCTTGTAATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011028
P2RX6 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011028.1-1331s1c1
Sequence:CCGGGCCTATTCATTCCTGAGGCTTCTCGAGAAGCCTCAGGAATGAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-653s1c1
Sequence:CCGGCTCCAGATCCAATGCCTTATTCTCGAGAATAAGGCATTGGATCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-887s1c1
Sequence:CCGGGCAGCAGAAAGGGTACAACTTCTCGAGAAGTTGTACCCTTTCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-162s1c1
Sequence:CCGGGCAGTGGTAGTCTACGTGATACTCGAGTATCACGTAGACTACCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-87s1c1
Sequence:CCGGCTGGATTACAAGACGGAGAAACTCGAGTTTCTCCGTCTTGTAATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011028
P2RX6 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011028.1-1331s1c1
Sequence:CCGGGCCTATTCATTCCTGAGGCTTCTCGAGAAGCCTCAGGAATGAATAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-653s1c1
Sequence:CCGGCTCCAGATCCAATGCCTTATTCTCGAGAATAAGGCATTGGATCTGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-887s1c1
Sequence:CCGGGCAGCAGAAAGGGTACAACTTCTCGAGAAGTTGTACCCTTTCTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-162s1c1
Sequence:CCGGGCAGTGGTAGTCTACGTGATACTCGAGTATCACGTAGACTACCACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011028.1-87s1c1
Sequence:CCGGCTGGATTACAAGACGGAGAAACTCGAGTTTCTCCGTCTTGTAATCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)