EMAIL THIS PAGE TO A FRIEND

P2RX7

purinergic receptor P2X, ligand-gated ion channel, 7

140 Gene Product Result for
Synonyms: P2X7
UniProtKB ID: Q99572, A8K2Z0, O14991, Q96EV7
Gene ID:
Human(5027) Summary: The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
Mouse(18439) purinergic receptor P2X, ligand-gated ion channel, 7
Rat(29665) purinergic receptor P2X, ligand-gated ion channel, 7
Zebrafish(387298) purinergic receptor P2X, ligand-gated ion channel, 7
chicken(771952) purinergic receptor P2X, ligand-gated ion channel, 7
cow(286814) purinergic receptor P2X, ligand-gated ion channel, 7
domestic cat(101097922) purinergic receptor P2X, ligand-gated ion channel, 7
Horse(100058464) purinergic receptor P2X, ligand-gated ion channel, 7
dog(448778) purinergic receptor P2X, ligand-gated ion channel, 7
domestic guinea pig(100379234) purinergic receptor P2X, ligand-gated ion channel, 7
naked mole-rat(101721795) purinergic receptor P2X, ligand-gated ion channel, 7
Domestic Rabbit(100351535) purinergic receptor P2X, ligand-gated ion channel, 7
sheep(101103842) purinergic receptor P2X, ligand-gated ion channel, 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501287 Anti-P2RX7 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AV35518 Anti-P2RX7 antibody produced in rabbit IgG fraction of antiserum rabbit, human, mouse
immunohistochemistry, western blot pricing
SAB2101706 Anti-P2RX7 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA034967 Anti-P2RX7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA034968 Anti-P2RX7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA042013 Anti-P2RX7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA044141 Anti-P2RX7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
P8232 Anti-P2X7 Purinergic Receptor antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, rat, human
immunohistochemistry, western blot pricing
P9122 Anti-Purinergic Receptor P2X7 (extracellular) antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, rat, human
western blot pricing
P8997 Anti-Purinergic Receptor P2X7 (extracellular)−FITC antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, rat, human
flow cytometry pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
I2142 KN-62 ≥95%, powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002562 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146001 MISSION® esiRNA esiRNA human P2RX7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002562 Rosetta Predictions human pricing
NM_019256 Rosetta Predictions rat pricing
NM_001038839 Rosetta Predictions mouse pricing
NM_001038845 Rosetta Predictions mouse pricing
NM_001038887 Rosetta Predictions mouse pricing
NM_011027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127827 predicted 1001
2 SASI_Hs01_00127828 predicted 562
3 SASI_Hs01_00127829 predicted 842
4 SASI_Hs01_00127830 predicted 359
5 SASI_Hs01_00127831 predicted 827
6 SASI_Hs01_00127832 predicted 633
7 SASI_Hs01_00127833 predicted 328
8 SASI_Hs01_00127835 predicted 852
9 SASI_Hs01_00127836 predicted 844
10 SASI_Hs02_00334053 predicted 352
11 SASI_Hs01_00127834 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262136 predicted 659
2 SASI_Rn01_00037468 predicted 1249
3 SASI_Rn01_00037469 predicted 428
4 SASI_Rn01_00037470 predicted 867
5 SASI_Rn01_00037471 predicted 752
6 SASI_Rn01_00037472 predicted 1878
7 SASI_Rn01_00037474 predicted 503
8 SASI_Rn01_00037475 predicted 1921
9 SASI_Rn01_00037476 predicted 1908
10 SASI_Rn02_00262137 predicted 199
11 SASI_Rn01_00037473 predicted 1490
12 SASI_Rn01_00037477 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289700 predicted 226
2 SASI_Mm02_00289701 predicted 210
3 SASI_Mm02_00289702 predicted 217
4 SASI_Mm02_00289703 predicted 250
5 SASI_Mm02_00289704 predicted 214
6 SASI_Mm02_00289705 predicted 288
7 SASI_Mm02_00289706 predicted 244
8 SASI_Mm02_00289707 predicted 230
9 SASI_Mm02_00289708 predicted 202
10 SASI_Mm02_00289709 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076501 predicted 230
2 SASI_Mm01_00076502 predicted 214
3 SASI_Mm01_00076503 predicted 214
4 SASI_Mm01_00076504 predicted 246
5 SASI_Mm01_00076505 predicted 214
6 SASI_Mm01_00076506 predicted 279
7 SASI_Mm01_00076507 predicted 242
8 SASI_Mm01_00076508 predicted 229
9 SASI_Mm01_00076509 predicted 205
10 SASI_Mm01_00076510 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126857 predicted 229
2 SASI_Mm01_00126858 predicted 211
3 SASI_Mm01_00126859 predicted 213
4 SASI_Mm01_00126860 predicted 244
5 SASI_Mm01_00126861 predicted 216
6 SASI_Mm01_00126862 predicted 286
7 SASI_Mm01_00126863 predicted 244
8 SASI_Mm01_00126864 predicted 229
9 SASI_Mm01_00126865 predicted 197
10 SASI_Mm01_00126866 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319751 predicted 226
2 SASI_Mm02_00319752 predicted 216
3 SASI_Mm02_00319753 predicted 212
4 SASI_Mm02_00319754 predicted 244
5 SASI_Mm02_00319755 predicted 217
6 SASI_Mm02_00319756 predicted 286
7 SASI_Mm02_00319757 predicted 242
8 SASI_Mm02_00319758 predicted 227
9 SASI_Mm02_00319759 predicted 201
10 SASI_Mm02_00319760 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011027
P2RX7 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 7
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000068568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-876s1c1
Sequence:CCGGCCCGGCTACAACTTCAGATATCTCGAGATATCTGAAGTTGTAGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-610s1c1
Sequence:CCGGGCCACAACTATACCACGAGAACTCGAGTTCTCGTGGTATAGTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-1368s1c1
Sequence:CCGGCCTGGACAATCTGAGGAAATTCTCGAGAATTTCCTCAGATTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-105s1c1
Sequence:CCGGGTCTTGCACATGATCGTCTTTCTCGAGAAAGACGATCATGTGCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011027
P2RX7 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 7
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000068568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-876s1c1
Sequence:CCGGCCCGGCTACAACTTCAGATATCTCGAGATATCTGAAGTTGTAGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-610s1c1
Sequence:CCGGGCCACAACTATACCACGAGAACTCGAGTTCTCGTGGTATAGTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-1368s1c1
Sequence:CCGGCCTGGACAATCTGAGGAAATTCTCGAGAATTTCCTCAGATTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-105s1c1
Sequence:CCGGGTCTTGCACATGATCGTCTTTCTCGAGAAAGACGATCATGTGCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011027
P2RX7 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 7
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000068568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-876s1c1
Sequence:CCGGCCCGGCTACAACTTCAGATATCTCGAGATATCTGAAGTTGTAGCCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-610s1c1
Sequence:CCGGGCCACAACTATACCACGAGAACTCGAGTTCTCGTGGTATAGTTGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-1368s1c1
Sequence:CCGGCCTGGACAATCTGAGGAAATTCTCGAGAATTTCCTCAGATTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011027.1-105s1c1
Sequence:CCGGGTCTTGCACATGATCGTCTTTCTCGAGAAAGACGATCATGTGCAAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002562
P2RX7 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2X, ligand-gated ion channel, 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-801s1c1
Sequence:CCGGCCGAGAAACAGGCGATAATTTCTCGAGAAATTATCGCCTGTTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-164s1c1
Sequence:CCGGGCATGAATTATGGCACCATTACTCGAGTAATGGTGCCATAATTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-1149s1c1
Sequence:CCGGCGACTTCCTCATCGACACTTACTCGAGTAAGTGTCGATGAGGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-843s1c1
Sequence:CCGGCGGAATAATGGGCATTGAGATCTCGAGATCTCAATGCCCATTATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-1860s1c1
Sequence:CCGGCAGTGGCTTCAAGAGTCCTTACTCGAGTAAGGACTCTTGAAGCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002562
P2RX7 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2X, ligand-gated ion channel, 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-801s1c1
Sequence:CCGGCCGAGAAACAGGCGATAATTTCTCGAGAAATTATCGCCTGTTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-164s1c1
Sequence:CCGGGCATGAATTATGGCACCATTACTCGAGTAATGGTGCCATAATTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-1149s1c1
Sequence:CCGGCGACTTCCTCATCGACACTTACTCGAGTAAGTGTCGATGAGGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-843s1c1
Sequence:CCGGCGGAATAATGGGCATTGAGATCTCGAGATCTCAATGCCCATTATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-1860s1c1
Sequence:CCGGCAGTGGCTTCAAGAGTCCTTACTCGAGTAAGGACTCTTGAAGCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002562
P2RX7 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2X, ligand-gated ion channel, 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-801s1c1
Sequence:CCGGCCGAGAAACAGGCGATAATTTCTCGAGAAATTATCGCCTGTTTCTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-164s1c1
Sequence:CCGGGCATGAATTATGGCACCATTACTCGAGTAATGGTGCCATAATTCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-1149s1c1
Sequence:CCGGCGACTTCCTCATCGACACTTACTCGAGTAAGTGTCGATGAGGAAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-843s1c1
Sequence:CCGGCGGAATAATGGGCATTGAGATCTCGAGATCTCAATGCCCATTATTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002562.4-1860s1c1
Sequence:CCGGCAGTGGCTTCAAGAGTCCTTACTCGAGTAAGGACTCTTGAAGCCACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)