EMAIL THIS PAGE TO A FRIEND

P2RY10

purinergic receptor P2Y, G-protein coupled, 10

79 Gene Product Result for
Synonyms: P2Y10
UniProtKB ID: O00398, D3DTE5, Q4VBN7, Q86V16
Gene ID:
Human(27334) Summary: The protein encoded by this gene belongs to the family of G-protein coupled receptors, that are preferentially activated by adenosine and uridine nucleotides. Two alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(78826) purinergic receptor P2Y, G-protein coupled 10
Rat(317219) purinergic receptor P2Y, G-protein coupled, 10
naked mole-rat(101703583) purinergic receptor P2Y, G-protein coupled, 10
Zebrafish(100037375) purinergic receptor P2Y, G-protein coupled, 10
chicken(422148) purinergic receptor P2Y, G-protein coupled, 10
dog(491980) purinergic receptor P2Y, G-protein coupled, 10
cow(515172) purinergic receptor P2Y, G-protein coupled, 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P178 Pyridoxal phosphate-6-azo(benzene-2,4-disulfonic acid) tetrasodium salt hydrate solid, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014499 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132861 MISSION® esiRNA esiRNA human P2RY10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014499 Rosetta Predictions human pricing
NM_198333 Rosetta Predictions human pricing
XM_001059224 Rosetta Predictions rat pricing
XM_228500 Rosetta Predictions rat pricing
NM_172435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076902 predicted 902
2 SASI_Hs01_00076903 predicted 1441
3 SASI_Hs01_00076904 predicted 979
4 SASI_Hs01_00076905 predicted 685
5 SASI_Hs01_00076906 predicted 1268
6 SASI_Hs01_00076907 predicted 918
7 SASI_Hs01_00076908 predicted 868
8 SASI_Hs01_00076909 predicted 1447
9 SASI_Hs01_00076910 predicted 881
10 SASI_Hs02_00345753 predicted 1125
11 SASI_Hs01_00076911 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170035 predicted 713
2 SASI_Hs01_00170036 predicted 1257
3 SASI_Hs01_00170037 predicted 784
4 SASI_Hs01_00170038 predicted 499
5 SASI_Hs01_00170039 predicted 1079
6 SASI_Hs01_00170040 predicted 718
7 SASI_Hs01_00170041 predicted 681
8 SASI_Hs01_00170042 predicted 1257
9 SASI_Hs01_00170043 predicted 686
10 SASI_Hs02_00371881 predicted 934
11 SASI_Hs01_00170044 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292494 predicted 773
2 SASI_Rn02_00292495 predicted 749
3 SASI_Rn02_00292496 predicted 721
4 SASI_Rn02_00292497 predicted 906
5 SASI_Rn02_00292498 predicted 1109
6 SASI_Rn02_00292499 predicted 917
7 SASI_Rn02_00292500 predicted 221
8 SASI_Rn02_00292501 predicted 989
9 SASI_Rn02_00292502 predicted 758
10 SASI_Rn02_00292503 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385152 predicted 771
2 SASI_Rn02_00385153 predicted 745
3 SASI_Rn02_00385154 predicted 1048
4 SASI_Rn02_00385155 predicted 712
5 SASI_Rn02_00385156 predicted 1019
6 SASI_Rn02_00385157 predicted 683
7 SASI_Rn02_00385158 predicted 1108
8 SASI_Rn02_00385159 predicted 984
9 SASI_Rn02_00385160 predicted 759
10 SASI_Rn02_00385161 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133511 predicted 351
2 SASI_Mm01_00133512 predicted 1242
3 SASI_Mm01_00133514 predicted 896
4 SASI_Mm01_00133516 predicted 1046
5 SASI_Mm01_00133517 predicted 1055
6 SASI_Mm01_00133518 predicted 343
7 SASI_Mm01_00133519 predicted 1275
8 SASI_Mm01_00133520 predicted 889
9 SASI_Mm02_00343922 predicted 1183
10 SASI_Mm02_00343923 predicted 1312
11 SASI_Mm01_00133513 predicted 813
12 SASI_Mm01_00133515 predicted 1384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014499
P2RY10 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014499.2-1133s21c1
Sequence:CCGGGCTTCACTCCCTATCATATTACTCGAGTAATATGATAGGGAGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014499.2-947s21c1
Sequence:CCGGTTGCGTTGGTCGGGATGATTACTCGAGTAATCATCCCGACCAACGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014499.2-1207s21c1
Sequence:CCGGGTCCGAATCGCACTGTATTTCCTCGAGGAAATACAGTGCGATTCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-1358s1c1
Sequence:CCGGGCAAGGAGAGTGGTTCATCAACTCGAGTTGATGAACCACTCTCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014499.2-1450s1c1
Sequence:CCGGGCCAGAATTGTCAACCAATTTCTCGAGAAATTGGTTGACAATTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-1215s1c1
Sequence:CCGGCGCACTGTATTTCCACCCTTTCTCGAGAAAGGGTGGAAATACAGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-473s1c1
Sequence:CCGGCCCTCTATGCAACCACCTATACTCGAGTATAGGTGGTTGCATAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-876s1c1
Sequence:CCGGCCTGAGAAGCACAGACTTAAACTCGAGTTTAAGTCTGTGCTTCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014499
P2RY10 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014499.2-1133s21c1
Sequence:CCGGGCTTCACTCCCTATCATATTACTCGAGTAATATGATAGGGAGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014499.2-947s21c1
Sequence:CCGGTTGCGTTGGTCGGGATGATTACTCGAGTAATCATCCCGACCAACGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014499.2-1207s21c1
Sequence:CCGGGTCCGAATCGCACTGTATTTCCTCGAGGAAATACAGTGCGATTCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-1358s1c1
Sequence:CCGGGCAAGGAGAGTGGTTCATCAACTCGAGTTGATGAACCACTCTCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014499.2-1450s1c1
Sequence:CCGGGCCAGAATTGTCAACCAATTTCTCGAGAAATTGGTTGACAATTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-1215s1c1
Sequence:CCGGCGCACTGTATTTCCACCCTTTCTCGAGAAAGGGTGGAAATACAGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-473s1c1
Sequence:CCGGCCCTCTATGCAACCACCTATACTCGAGTATAGGTGGTTGCATAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-876s1c1
Sequence:CCGGCCTGAGAAGCACAGACTTAAACTCGAGTTTAAGTCTGTGCTTCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014499
P2RY10 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014499.2-1133s21c1
Sequence:CCGGGCTTCACTCCCTATCATATTACTCGAGTAATATGATAGGGAGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014499.2-947s21c1
Sequence:CCGGTTGCGTTGGTCGGGATGATTACTCGAGTAATCATCCCGACCAACGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014499.2-1207s21c1
Sequence:CCGGGTCCGAATCGCACTGTATTTCCTCGAGGAAATACAGTGCGATTCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-1358s1c1
Sequence:CCGGGCAAGGAGAGTGGTTCATCAACTCGAGTTGATGAACCACTCTCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014499.2-1450s1c1
Sequence:CCGGGCCAGAATTGTCAACCAATTTCTCGAGAAATTGGTTGACAATTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-1215s1c1
Sequence:CCGGCGCACTGTATTTCCACCCTTTCTCGAGAAAGGGTGGAAATACAGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-473s1c1
Sequence:CCGGCCCTCTATGCAACCACCTATACTCGAGTATAGGTGGTTGCATAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014499.2-876s1c1
Sequence:CCGGCCTGAGAAGCACAGACTTAAACTCGAGTTTAAGTCTGTGCTTCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172435
P2RY10 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-742s1c1
Sequence:CCGGGCTGTCATCTGGATTGTTGTACTCGAGTACAACAATCCAGATGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1222s1c1
Sequence:CCGGCGTGACCAACTATCTCGTCATCTCGAGATGACGAGATAGTTGGTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1188s1c1
Sequence:CCGGCCCAATTCTGTACTATTTCATCTCGAGATGAAATAGTACAGAATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1281s1c1
Sequence:CCGGGAGTGGATCATCAATGGTTAACTCGAGTTAACCATTGATGATCCACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1049s1c1
Sequence:CCGGGCTTCACTCCTTATCACATTACTCGAGTAATGTGATAAGGAGTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172435
P2RY10 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-742s1c1
Sequence:CCGGGCTGTCATCTGGATTGTTGTACTCGAGTACAACAATCCAGATGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1222s1c1
Sequence:CCGGCGTGACCAACTATCTCGTCATCTCGAGATGACGAGATAGTTGGTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1188s1c1
Sequence:CCGGCCCAATTCTGTACTATTTCATCTCGAGATGAAATAGTACAGAATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1281s1c1
Sequence:CCGGGAGTGGATCATCAATGGTTAACTCGAGTTAACCATTGATGATCCACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1049s1c1
Sequence:CCGGGCTTCACTCCTTATCACATTACTCGAGTAATGTGATAAGGAGTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172435
P2RY10 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-742s1c1
Sequence:CCGGGCTGTCATCTGGATTGTTGTACTCGAGTACAACAATCCAGATGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1222s1c1
Sequence:CCGGCGTGACCAACTATCTCGTCATCTCGAGATGACGAGATAGTTGGTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1188s1c1
Sequence:CCGGCCCAATTCTGTACTATTTCATCTCGAGATGAAATAGTACAGAATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1281s1c1
Sequence:CCGGGAGTGGATCATCAATGGTTAACTCGAGTTAACCATTGATGATCCACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172435.2-1049s1c1
Sequence:CCGGGCTTCACTCCTTATCACATTACTCGAGTAATGTGATAAGGAGTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)