EMAIL THIS PAGE TO A FRIEND

P2RY11

purinergic receptor P2Y, G-protein coupled, 11

27 Gene Product Result for
Synonyms: P2Y11
UniProtKB ID: Q96G91, B2R8X9, O43190, Q9BYU4, Q9H170
Gene ID:
Human(5032) Summary: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is coupled to the stimulation of the phosphoinositide and adenylyl cyclase pathways and behaves as a selective purinoceptor. Naturally occuring read-through transcripts, resulting from intergenic splicing between this gene and an immediately upstream gene (PPAN, encoding peter pan homolog), have been found. The PPAN-P2RY11 read-through mRNA is ubiquitously expressed and encodes a fusion protein that shares identity with each individual gene product. [provided by RefSeq, Jul 2008]
Zebrafish(100007926) purinergic receptor P2Y, G-protein coupled, 11
dog(100533479) purinergic receptor P2Y, G-protein coupled, 11
cow(100533481) purinergic receptor P2Y, G-protein coupled, 11
Horse(100533526) purinergic receptor P2Y, G-protein coupled, 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002566 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002566 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011106 predicted 970
2 SASI_Hs01_00011107 predicted 907
3 SASI_Hs01_00011108 predicted 987
4 SASI_Hs01_00011109 predicted 962
5 SASI_Hs01_00011110 predicted 961
6 SASI_Hs01_00011111 predicted 689
7 SASI_Hs01_00011112 predicted 905
8 SASI_Hs01_00011113 predicted 971
9 SASI_Hs01_00011114 predicted 890
10 SASI_Hs01_00011115 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002566
P2RY11 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002566.3-1403s1c1
Sequence:CCGGGAGAGAGTGGAGCTGCTTTATCTCGAGATAAAGCAGCTCCACTCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-57s1c1
Sequence:CCGGCGACGACAAACTCAGTGGGTTCTCGAGAACCCACTGAGTTTGTCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-952s1c1
Sequence:CCGGCCTCTACTCTACATGGCCGCACTCGAGTGCGGCCATGTAGAGTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-844s1c1
Sequence:CCGGTGCCCGAGCTTTGCAGACATACTCGAGTATGTCTGCAAAGCTCGGGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-315s1c1
Sequence:CCGGGCGCTTCCTCTTCACCTGCAACTCGAGTTGCAGGTGAAGAGGAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002566.4-1772s21c1
Sequence:CCGGAGACACCCAAGTGGCATCTTGCTCGAGCAAGATGCCACTTGGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002566.4-1730s21c1
Sequence:CCGGAGGGTGGCAGGTATAAGACTTCTCGAGAAGTCTTATACCTGCCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002566.4-1567s21c1
Sequence:CCGGACAGGACTGGAGACGCAAGAACTCGAGTTCTTGCGTCTCCAGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002566.4-1309s21c1
Sequence:CCGGCGTGAGCTGAGCCAATGATGTCTCGAGACATCATTGGCTCAGCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002566
P2RY11 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002566.3-1403s1c1
Sequence:CCGGGAGAGAGTGGAGCTGCTTTATCTCGAGATAAAGCAGCTCCACTCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-57s1c1
Sequence:CCGGCGACGACAAACTCAGTGGGTTCTCGAGAACCCACTGAGTTTGTCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-952s1c1
Sequence:CCGGCCTCTACTCTACATGGCCGCACTCGAGTGCGGCCATGTAGAGTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-844s1c1
Sequence:CCGGTGCCCGAGCTTTGCAGACATACTCGAGTATGTCTGCAAAGCTCGGGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-315s1c1
Sequence:CCGGGCGCTTCCTCTTCACCTGCAACTCGAGTTGCAGGTGAAGAGGAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002566.4-1772s21c1
Sequence:CCGGAGACACCCAAGTGGCATCTTGCTCGAGCAAGATGCCACTTGGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002566.4-1730s21c1
Sequence:CCGGAGGGTGGCAGGTATAAGACTTCTCGAGAAGTCTTATACCTGCCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002566.4-1567s21c1
Sequence:CCGGACAGGACTGGAGACGCAAGAACTCGAGTTCTTGCGTCTCCAGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002566.4-1309s21c1
Sequence:CCGGCGTGAGCTGAGCCAATGATGTCTCGAGACATCATTGGCTCAGCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002566
P2RY11 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002566.3-1403s1c1
Sequence:CCGGGAGAGAGTGGAGCTGCTTTATCTCGAGATAAAGCAGCTCCACTCTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-57s1c1
Sequence:CCGGCGACGACAAACTCAGTGGGTTCTCGAGAACCCACTGAGTTTGTCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-952s1c1
Sequence:CCGGCCTCTACTCTACATGGCCGCACTCGAGTGCGGCCATGTAGAGTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-844s1c1
Sequence:CCGGTGCCCGAGCTTTGCAGACATACTCGAGTATGTCTGCAAAGCTCGGGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002566.3-315s1c1
Sequence:CCGGGCGCTTCCTCTTCACCTGCAACTCGAGTTGCAGGTGAAGAGGAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002566.4-1772s21c1
Sequence:CCGGAGACACCCAAGTGGCATCTTGCTCGAGCAAGATGCCACTTGGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002566.4-1730s21c1
Sequence:CCGGAGGGTGGCAGGTATAAGACTTCTCGAGAAGTCTTATACCTGCCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002566.4-1567s21c1
Sequence:CCGGACAGGACTGGAGACGCAAGAACTCGAGTTCTTGCGTCTCCAGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002566.4-1309s21c1
Sequence:CCGGCGTGAGCTGAGCCAATGATGTCTCGAGACATCATTGGCTCAGCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)