EMAIL THIS PAGE TO A FRIEND

P2RY12

purinergic receptor P2Y, G-protein coupled, 12

61 Gene Product Result for
Synonyms: ADPG-R BDPLT8 HORK3 P2T(AC) P2Y(12)R P2Y(AC) P2Y(ADP) P2Y(cyc) P2Y12 SP1999
UniProtKB ID: Q9H244, D3DNJ5, Q546J7
Gene ID:
Human(64805) Summary: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Mouse(70839) purinergic receptor P2Y, G-protein coupled 12
Rat(64803) purinergic receptor P2Y, G-protein coupled, 12
cow(408007) purinergic receptor P2Y, G-protein coupled, 12
domestic cat(101094044) purinergic receptor P2Y, G-protein coupled, 12
dog(442958) purinergic receptor P2Y, G-protein coupled, 12
sheep(101117897) purinergic receptor P2Y, G-protein coupled, 12
naked mole-rat(101701294) purinergic receptor P2Y, G-protein coupled, 12
domestic guinea pig(100720551) purinergic receptor P2Y, G-protein coupled, 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P178 Pyridoxal phosphate-6-azo(benzene-2,4-disulfonic acid) tetrasodium salt hydrate solid, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176876 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022788 Rosetta Predictions human pricing
NM_176876 Rosetta Predictions human pricing
NM_022800 Rosetta Predictions rat pricing
NM_027571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187237 predicted 1156
2 SASI_Hs01_00187238 predicted 395
3 SASI_Hs01_00187239 predicted 535
4 SASI_Hs01_00187240 predicted 701
5 SASI_Hs01_00187241 predicted 691
6 SASI_Hs01_00187242 predicted 797
7 SASI_Hs01_00187243 predicted 762
8 SASI_Hs01_00187244 predicted 675
9 SASI_Hs01_00187245 predicted 659
10 SASI_Hs02_00356097 predicted 862
11 SASI_Hs01_00187236 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046349 predicted 1125
2 SASI_Hs01_00046350 predicted 368
3 SASI_Hs01_00046351 predicted 502
4 SASI_Hs01_00046352 predicted 677
5 SASI_Hs01_00046353 predicted 658
6 SASI_Hs01_00046354 predicted 774
7 SASI_Hs01_00046355 predicted 735
8 SASI_Hs01_00046356 predicted 648
9 SASI_Hs01_00046357 predicted 632
10 SASI_Hs02_00369259 predicted 828
11 SASI_Hs01_00046348 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117245 predicted 470
2 SASI_Rn01_00117247 predicted 227
3 SASI_Rn01_00117248 predicted 901
4 SASI_Rn01_00117249 predicted 641
5 SASI_Rn01_00117250 predicted 885
6 SASI_Rn01_00117251 predicted 659
7 SASI_Rn02_00263559 predicted 598
8 SASI_Rn01_00117252 predicted 924
9 SASI_Rn01_00117253 predicted 613
10 SASI_Rn01_00117254 predicted 756
11 SASI_Rn01_00117246 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113045 predicted 993
2 SASI_Mm01_00113046 predicted 1384
3 SASI_Mm01_00113047 predicted 568
4 SASI_Mm01_00113048 predicted 576
5 SASI_Mm01_00113049 predicted 533
6 SASI_Mm01_00113050 predicted 932
7 SASI_Mm01_00113051 predicted 661
8 SASI_Mm02_00332403 predicted 1090
9 SASI_Mm01_00113052 predicted 573
10 SASI_Mm02_00332404 predicted 474
11 SASI_Mm01_00113053 predicted 908
12 SASI_Mm01_00113054 predicted 1224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176876
P2RY12 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176876.1-1277s21c1
Sequence:CCGGTTGTGTTCAGAACTCGTTAAACTCGAGTTTAACGAGTTCTGAACACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176876.1-374s21c1
Sequence:CCGGTCCGGAGTAAATCAAACTTTACTCGAGTAAAGTTTGATTTACTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176876.1-508s21c1
Sequence:CCGGCAAGTTACCTCCGTCATATTTCTCGAGAAATATGACGGAGGTAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-1221s1c1
Sequence:CCGGCCCAAATGAAGAGACTCCAATCTCGAGATTGGAGTCTCTTCATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176876.1-1275s1c1
Sequence:CCGGCTTTGTGTTCAGAACTCGTTACTCGAGTAACGAGTTCTGAACACAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-375s1c1
Sequence:CCGGCCGGAGTAAATCAAACTTTATCTCGAGATAAAGTTTGATTTACTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-687s1c1
Sequence:CCGGGCCTAACATGATTCTGACCAACTCGAGTTGGTCAGAATCATGTTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-762s1c1
Sequence:CCGGCGGTCTAGTCTGGCATGAAATCTCGAGATTTCATGCCAGACTAGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176876
P2RY12 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176876.1-1277s21c1
Sequence:CCGGTTGTGTTCAGAACTCGTTAAACTCGAGTTTAACGAGTTCTGAACACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176876.1-374s21c1
Sequence:CCGGTCCGGAGTAAATCAAACTTTACTCGAGTAAAGTTTGATTTACTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176876.1-508s21c1
Sequence:CCGGCAAGTTACCTCCGTCATATTTCTCGAGAAATATGACGGAGGTAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-1221s1c1
Sequence:CCGGCCCAAATGAAGAGACTCCAATCTCGAGATTGGAGTCTCTTCATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176876.1-1275s1c1
Sequence:CCGGCTTTGTGTTCAGAACTCGTTACTCGAGTAACGAGTTCTGAACACAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-375s1c1
Sequence:CCGGCCGGAGTAAATCAAACTTTATCTCGAGATAAAGTTTGATTTACTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-687s1c1
Sequence:CCGGGCCTAACATGATTCTGACCAACTCGAGTTGGTCAGAATCATGTTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-762s1c1
Sequence:CCGGCGGTCTAGTCTGGCATGAAATCTCGAGATTTCATGCCAGACTAGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176876
P2RY12 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176876.1-1277s21c1
Sequence:CCGGTTGTGTTCAGAACTCGTTAAACTCGAGTTTAACGAGTTCTGAACACAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176876.1-374s21c1
Sequence:CCGGTCCGGAGTAAATCAAACTTTACTCGAGTAAAGTTTGATTTACTCCGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176876.1-508s21c1
Sequence:CCGGCAAGTTACCTCCGTCATATTTCTCGAGAAATATGACGGAGGTAACTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-1221s1c1
Sequence:CCGGCCCAAATGAAGAGACTCCAATCTCGAGATTGGAGTCTCTTCATTTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176876.1-1275s1c1
Sequence:CCGGCTTTGTGTTCAGAACTCGTTACTCGAGTAACGAGTTCTGAACACAAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-375s1c1
Sequence:CCGGCCGGAGTAAATCAAACTTTATCTCGAGATAAAGTTTGATTTACTCCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-687s1c1
Sequence:CCGGGCCTAACATGATTCTGACCAACTCGAGTTGGTCAGAATCATGTTAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176876.1-762s1c1
Sequence:CCGGCGGTCTAGTCTGGCATGAAATCTCGAGATTTCATGCCAGACTAGACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027571
VALIDATED
P2RY12 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-522s21c1
Sequence:CCGGTTCTTTCAGATCCGCAGTAAACTCGAGTTTACTGCGGATCTGAAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027571.3-1848s21c1
Sequence:CCGGATGGATAAGGCCTGGATTATTCTCGAGAATAATCCAGGCCTTATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-932s21c1
Sequence:CCGGGCACGAAATAGTCAATTACATCTCGAGATGTAATTGACTATTTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-664s21c1
Sequence:CCGGGCCAAGTTACTTCAGTCACATCTCGAGATGTGACTGAAGTAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-598s1c1
Sequence:CCGGCCGCAGTAAATCCAACTTCATCTCGAGATGAAGTTGGATTTACTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-729s1c1
Sequence:CCGGGCCAAGTTACTTCAGTCACATCTCGAGATGTGACTGAAGTAACTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-997s1c1
Sequence:CCGGGCACGAAATAGTCAATTACATCTCGAGATGTAATTGACTATTTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027571.2-1288s1c1
Sequence:CCGGCCTATGGCTTACGTCACTGAACTCGAGTTCAGTGACGTAAGCCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-636s1c1
Sequence:CCGGCGGTCATCTCTGATCTACTAACTCGAGTTAGTAGATCAGAGATGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-572s21c1
Sequence:CCGGGGTCATCTCTGATCTACTAATCTCGAGATTAGTAGATCAGAGATGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027571
VALIDATED
P2RY12 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-522s21c1
Sequence:CCGGTTCTTTCAGATCCGCAGTAAACTCGAGTTTACTGCGGATCTGAAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027571.3-1848s21c1
Sequence:CCGGATGGATAAGGCCTGGATTATTCTCGAGAATAATCCAGGCCTTATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-932s21c1
Sequence:CCGGGCACGAAATAGTCAATTACATCTCGAGATGTAATTGACTATTTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-664s21c1
Sequence:CCGGGCCAAGTTACTTCAGTCACATCTCGAGATGTGACTGAAGTAACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-598s1c1
Sequence:CCGGCCGCAGTAAATCCAACTTCATCTCGAGATGAAGTTGGATTTACTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-729s1c1
Sequence:CCGGGCCAAGTTACTTCAGTCACATCTCGAGATGTGACTGAAGTAACTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-997s1c1
Sequence:CCGGGCACGAAATAGTCAATTACATCTCGAGATGTAATTGACTATTTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027571.2-1288s1c1
Sequence:CCGGCCTATGGCTTACGTCACTGAACTCGAGTTCAGTGACGTAAGCCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-636s1c1
Sequence:CCGGCGGTCATCTCTGATCTACTAACTCGAGTTAGTAGATCAGAGATGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-572s21c1
Sequence:CCGGGGTCATCTCTGATCTACTAATCTCGAGATTAGTAGATCAGAGATGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027571
VALIDATED
P2RY12 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-522s21c1
Sequence:CCGGTTCTTTCAGATCCGCAGTAAACTCGAGTTTACTGCGGATCTGAAAGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027571.3-1848s21c1
Sequence:CCGGATGGATAAGGCCTGGATTATTCTCGAGAATAATCCAGGCCTTATCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-932s21c1
Sequence:CCGGGCACGAAATAGTCAATTACATCTCGAGATGTAATTGACTATTTCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-664s21c1
Sequence:CCGGGCCAAGTTACTTCAGTCACATCTCGAGATGTGACTGAAGTAACTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-598s1c1
Sequence:CCGGCCGCAGTAAATCCAACTTCATCTCGAGATGAAGTTGGATTTACTGCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-729s1c1
Sequence:CCGGGCCAAGTTACTTCAGTCACATCTCGAGATGTGACTGAAGTAACTTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-997s1c1
Sequence:CCGGGCACGAAATAGTCAATTACATCTCGAGATGTAATTGACTATTTCGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027571.2-1288s1c1
Sequence:CCGGCCTATGGCTTACGTCACTGAACTCGAGTTCAGTGACGTAAGCCATAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027571.2-636s1c1
Sequence:CCGGCGGTCATCTCTGATCTACTAACTCGAGTTAGTAGATCAGAGATGACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027571.3-572s21c1
Sequence:CCGGGGTCATCTCTGATCTACTAATCTCGAGATTAGTAGATCAGAGATGACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)