EMAIL THIS PAGE TO A FRIEND

P2RY13

purinergic receptor P2Y, G-protein coupled, 13

83 Gene Product Result for
Synonyms: GPCR1 GPR86 GPR94 P2Y13 SP174
Gene ID:
Human(53829) Summary: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is activated by ADP. [provided by RefSeq, Sep 2008]
Mouse(74191) purinergic receptor P2Y, G-protein coupled 13
Rat(310444) purinergic receptor P2Y, G-protein coupled, 13
domestic guinea pig(100720000) purinergic receptor P2Y, G-protein coupled, 13
naked mole-rat(101702781) purinergic receptor P2Y, G-protein coupled, 13
sheep(101123088) purinergic receptor P2Y, G-protein coupled, 13
chicken(771793) purinergic receptor P2Y, G-protein coupled, 13
cow(782774) purinergic receptor P2Y, G-protein coupled, 13
domestic cat(101093636) purinergic receptor P2Y, G-protein coupled, 13
dog(609841) purinergic receptor P2Y, G-protein coupled, 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P178 Pyridoxal phosphate-6-azo(benzene-2,4-disulfonic acid) tetrasodium salt hydrate solid, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176894 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130181 MISSION® esiRNA esiRNA human P2RY13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023914 Rosetta Predictions human pricing
NM_176894 Rosetta Predictions human pricing
NM_001002853 Rosetta Predictions rat pricing
XM_579095 Rosetta Predictions rat pricing
NM_028808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055372 predicted 590
2 SASI_Hs01_00055373 predicted 1043
3 SASI_Hs01_00055375 predicted 1174
4 SASI_Hs01_00055376 predicted 805
5 SASI_Hs01_00055377 predicted 956
6 SASI_Hs02_00356363 predicted 506
7 SASI_Hs01_00055378 predicted 637
8 SASI_Hs01_00055379 predicted 355
9 SASI_Hs01_00055380 predicted 385
10 SASI_Hs01_00055381 predicted 814
11 SASI_Hs01_00055374 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071463 predicted 503
2 SASI_Hs01_00071464 predicted 956
3 SASI_Hs01_00071466 predicted 1081
4 SASI_Hs01_00071467 predicted 719
5 SASI_Hs01_00071468 predicted 862
6 SASI_Hs02_00369291 predicted 422
7 SASI_Hs01_00071469 predicted 548
8 SASI_Hs01_00071470 predicted 271
9 SASI_Hs01_00071471 predicted 293
10 SASI_Hs01_00071472 predicted 718
11 SASI_Hs01_00071465 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046386 predicted 518
2 SASI_Rn01_00046387 predicted 648
3 SASI_Rn01_00046388 predicted 220
4 SASI_Rn01_00046389 predicted 319
5 SASI_Rn01_00046390 predicted 647
6 SASI_Rn01_00046391 predicted 317
7 SASI_Rn01_00046392 predicted 344
8 SASI_Rn01_00046393 predicted 558
9 SASI_Rn01_00046394 predicted 565
10 SASI_Rn01_00046395 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168049 predicted 644
2 SASI_Rn01_00168050 predicted 653
3 SASI_Rn01_00168051 predicted 652
4 SASI_Rn01_00168052 predicted 773
5 SASI_Rn01_00168053 predicted 655
6 SASI_Rn01_00168054 predicted 708
7 SASI_Rn01_00168055 predicted 705
8 SASI_Rn01_00168056 predicted 660
9 SASI_Rn01_00168057 predicted 708
10 SASI_Rn01_00168058 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334423 predicted 540
2 SASI_Mm01_00049102 predicted 705
3 SASI_Mm01_00049103 predicted 1161
4 SASI_Mm01_00049104 predicted 818
5 SASI_Mm01_00049105 predicted 345
6 SASI_Mm01_00049106 predicted 1117
7 SASI_Mm01_00049107 predicted 232
8 SASI_Mm01_00049108 predicted 1138
9 SASI_Mm01_00049109 predicted 419
10 SASI_Mm01_00049110 predicted 270
11 SASI_Mm01_00049111 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176894
P2RY13 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176894.1-445s1c1
Sequence:CCGGCCTCAAGATCATCAGACCTTTCTCGAGAAAGGTCTGATGATCTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008961    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176894.1-1689s1c1
Sequence:CCGGGCACCATTATTAAGCCACTTTCTCGAGAAAGTGGCTTAATAATGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176894.2-948s21c1
Sequence:CCGGCATTTGTATGGATCCCTTAATCTCGAGATTAAGGGATCCATACAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176894.2-1378s21c1
Sequence:CCGGAGACTAAGGAGAAACGTATATCTCGAGATATACGTTTCTCCTTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176894.2-1085s21c1
Sequence:CCGGGACAACTGTACATAGGGTTAACTCGAGTTAACCCTATGTACAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176894.1-547s1c1
Sequence:CCGGGCCAAATACGATCTTGAGCAACTCGAGTTGCTCAAGATCGTATTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176894.1-283s1c1
Sequence:CCGGCGACTTGATAATGACACTCATCTCGAGATGAGTGTCATTATCAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176894.2-1118s21c1
Sequence:CCGGGATGAGACTTCCGTAGATAATCTCGAGATTATCTACGGAAGTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176894
P2RY13 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176894.1-445s1c1
Sequence:CCGGCCTCAAGATCATCAGACCTTTCTCGAGAAAGGTCTGATGATCTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008961    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176894.1-1689s1c1
Sequence:CCGGGCACCATTATTAAGCCACTTTCTCGAGAAAGTGGCTTAATAATGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176894.2-948s21c1
Sequence:CCGGCATTTGTATGGATCCCTTAATCTCGAGATTAAGGGATCCATACAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176894.2-1378s21c1
Sequence:CCGGAGACTAAGGAGAAACGTATATCTCGAGATATACGTTTCTCCTTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176894.2-1085s21c1
Sequence:CCGGGACAACTGTACATAGGGTTAACTCGAGTTAACCCTATGTACAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176894.1-547s1c1
Sequence:CCGGGCCAAATACGATCTTGAGCAACTCGAGTTGCTCAAGATCGTATTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176894.1-283s1c1
Sequence:CCGGCGACTTGATAATGACACTCATCTCGAGATGAGTGTCATTATCAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176894.2-1118s21c1
Sequence:CCGGGATGAGACTTCCGTAGATAATCTCGAGATTATCTACGGAAGTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176894
P2RY13 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176894.1-445s1c1
Sequence:CCGGCCTCAAGATCATCAGACCTTTCTCGAGAAAGGTCTGATGATCTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008961    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176894.1-1689s1c1
Sequence:CCGGGCACCATTATTAAGCCACTTTCTCGAGAAAGTGGCTTAATAATGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176894.2-948s21c1
Sequence:CCGGCATTTGTATGGATCCCTTAATCTCGAGATTAAGGGATCCATACAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176894.2-1378s21c1
Sequence:CCGGAGACTAAGGAGAAACGTATATCTCGAGATATACGTTTCTCCTTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176894.2-1085s21c1
Sequence:CCGGGACAACTGTACATAGGGTTAACTCGAGTTAACCCTATGTACAGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176894.1-547s1c1
Sequence:CCGGGCCAAATACGATCTTGAGCAACTCGAGTTGCTCAAGATCGTATTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176894.1-283s1c1
Sequence:CCGGCGACTTGATAATGACACTCATCTCGAGATGAGTGTCATTATCAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176894.2-1118s21c1
Sequence:CCGGGATGAGACTTCCGTAGATAATCTCGAGATTATCTACGGAAGTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028808
P2RY13 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 13
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-1043s1c1
Sequence:CCGGCCACAGTAGTCAGACAGACAACTCGAGTTGTCTGTCTGACTACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028808.1-1118s1c1
Sequence:CCGGCGTCTATTTATGGATGGGATTCTCGAGAATCCCATCCATAAATAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-856s1c1
Sequence:CCGGCCACCAATAAGACTGACTGTACTCGAGTACAGTCAGTCTTATTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-374s1c1
Sequence:CCGGCGTGGTCTTCTATGAGACGATCTCGAGATCGTCTCATAGAAGACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-440s1c1
Sequence:CCGGCCTCAAGATCATCATGCCGTTCTCGAGAACGGCATGATGATCTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028808.3-639s21c1
Sequence:CCGGGTCACACCTGCCAGTTCATTTCTCGAGAAATGAACTGGCAGGTGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028808.3-717s21c1
Sequence:CCGGACAACTCCTATAGGAAGTTTACTCGAGTAAACTTCCTATAGGAGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028808
P2RY13 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 13
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-1043s1c1
Sequence:CCGGCCACAGTAGTCAGACAGACAACTCGAGTTGTCTGTCTGACTACTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028808.1-1118s1c1
Sequence:CCGGCGTCTATTTATGGATGGGATTCTCGAGAATCCCATCCATAAATAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-856s1c1
Sequence:CCGGCCACCAATAAGACTGACTGTACTCGAGTACAGTCAGTCTTATTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-374s1c1
Sequence:CCGGCGTGGTCTTCTATGAGACGATCTCGAGATCGTCTCATAGAAGACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-440s1c1
Sequence:CCGGCCTCAAGATCATCATGCCGTTCTCGAGAACGGCATGATGATCTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028808.3-639s21c1
Sequence:CCGGGTCACACCTGCCAGTTCATTTCTCGAGAAATGAACTGGCAGGTGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028808.3-717s21c1
Sequence:CCGGACAACTCCTATAGGAAGTTTACTCGAGTAAACTTCCTATAGGAGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028808
P2RY13 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 13
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-1043s1c1
Sequence:CCGGCCACAGTAGTCAGACAGACAACTCGAGTTGTCTGTCTGACTACTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028808.1-1118s1c1
Sequence:CCGGCGTCTATTTATGGATGGGATTCTCGAGAATCCCATCCATAAATAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-856s1c1
Sequence:CCGGCCACCAATAAGACTGACTGTACTCGAGTACAGTCAGTCTTATTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-374s1c1
Sequence:CCGGCGTGGTCTTCTATGAGACGATCTCGAGATCGTCTCATAGAAGACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028808.1-440s1c1
Sequence:CCGGCCTCAAGATCATCATGCCGTTCTCGAGAACGGCATGATGATCTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028808.3-639s21c1
Sequence:CCGGGTCACACCTGCCAGTTCATTTCTCGAGAAATGAACTGGCAGGTGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028808.3-717s21c1
Sequence:CCGGACAACTCCTATAGGAAGTTTACTCGAGTAAACTTCCTATAGGAGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)