EMAIL THIS PAGE TO A FRIEND

P2RY14

purinergic receptor P2Y, G-protein coupled, 14

84 Gene Product Result for
Synonyms: BPR105 GPR105 P2Y14
UniProtKB ID: Q15391, Q8IYT7
Gene ID:
Human(9934) Summary: The product of this gene belongs to the family of G-protein coupled receptors, which contains several receptor subtypes with different pharmacological selectivity for various adenosine and uridine nucleotides. This receptor is a P2Y purinergic receptor for UDP-glucose and other UDP-sugars coupled to G-proteins. It has been implicated in extending the known immune system functions of P2Y receptors by participating in the regulation of the stem cell compartment, and it may also play a role in neuroimmune function. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(140795) purinergic receptor P2Y, G-protein coupled, 14
Rat(171108) purinergic receptor P2Y, G-protein coupled, 14
chicken(425039) purinergic receptor P2Y, G-protein coupled, 14
chicken(101669253) purinergic receptor P2Y, G-protein coupled, 14
cow(767936) purinergic receptor P2Y, G-protein coupled, 14
domestic cat(101093387) purinergic receptor P2Y, G-protein coupled, 14
dog(485717) purinergic receptor P2Y, G-protein coupled, 14
chicken(101749627) purinergic receptor P2Y, G-protein coupled, 14
sheep(101117637) purinergic receptor P2Y, G-protein coupled, 14
naked mole-rat(101703159) purinergic receptor P2Y, G-protein coupled, 14
domestic guinea pig(100719721) purinergic receptor P2Y, G-protein coupled, 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P178 Pyridoxal phosphate-6-azo(benzene-2,4-disulfonic acid) tetrasodium salt hydrate solid, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014879 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044661 MISSION® esiRNA esiRNA human P2RY14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081455 Rosetta Predictions human pricing
NM_014879 Rosetta Predictions human pricing
NM_133577 Rosetta Predictions rat pricing
NM_001008497 Rosetta Predictions mouse pricing
NM_133200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316343 predicted 1155
2 SASI_Hs02_00316344 predicted 902
3 SASI_Hs02_00316345 predicted 665
4 SASI_Hs02_00316346 predicted 1383
5 SASI_Hs02_00316347 predicted 1139
6 SASI_Hs02_00316348 predicted 1397
7 SASI_Hs02_00316349 predicted 1264
8 SASI_Hs02_00316350 predicted 1361
9 SASI_Hs02_00316351 predicted 934
10 SASI_Hs02_00316352 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170005 predicted 968
2 SASI_Hs01_00170006 predicted 710
3 SASI_Hs01_00170008 predicted 475
4 SASI_Hs02_00346495 predicted 1195
5 SASI_Hs01_00170009 predicted 952
6 SASI_Hs01_00170010 predicted 1204
7 SASI_Hs01_00170011 predicted 1073
8 SASI_Hs01_00170012 predicted 1169
9 SASI_Hs02_00346496 predicted 750
10 SASI_Hs01_00170013 predicted 459
11 SASI_Hs01_00170007 predicted 431
12 SASI_Hs01_00170014 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267773 predicted 507
2 SASI_Rn01_00110188 predicted 576
3 SASI_Rn01_00110189 predicted 1169
4 SASI_Rn01_00110190 predicted 1134
5 SASI_Rn01_00110191 predicted 417
6 SASI_Rn01_00110192 predicted 1121
7 SASI_Rn02_00267774 predicted 891
8 SASI_Rn01_00110194 predicted 722
9 SASI_Rn01_00110195 predicted 856
10 SASI_Rn01_00110197 predicted 1106
11 SASI_Rn01_00110193 predicted 357
12 SASI_Rn01_00110196 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078054 predicted 1355
2 SASI_Mm01_00078055 predicted 1183
3 SASI_Mm02_00286801 predicted 1254
4 SASI_Mm02_00286802 predicted 551
5 SASI_Mm01_00078056 predicted 640
6 SASI_Mm01_00078058 predicted 1364
7 SASI_Mm01_00078061 predicted 1146
8 SASI_Mm01_00078062 predicted 593
9 SASI_Mm01_00078063 predicted 1352
10 SASI_Mm02_00286803 predicted 1341
11 SASI_Mm01_00078057 predicted 1367
12 SASI_Mm01_00078059 predicted 447
13 SASI_Mm01_00078060 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170566 predicted 1486
2 SASI_Mm01_00170567 predicted 1302
3 SASI_Mm02_00338391 predicted 1377
4 SASI_Mm02_00338392 predicted 676
5 SASI_Mm01_00170568 predicted 763
6 SASI_Mm01_00170570 predicted 1493
7 SASI_Mm01_00170573 predicted 1269
8 SASI_Mm01_00170574 predicted 720
9 SASI_Mm01_00170575 predicted 1476
10 SASI_Mm02_00338393 predicted 1469
11 SASI_Mm01_00170569 predicted 1499
12 SASI_Mm01_00170571 predicted 569
13 SASI_Mm01_00170572 predicted 1292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014879
P2RY14 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 14
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014879.3-1150s21c1
Sequence:CCGGGTATGCTTGGACCCTATTATTCTCGAGAATAATAGGGTCCAAGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014879.3-975s21c1
Sequence:CCGGGAAATCTAGCCGCAACATATTCTCGAGAATATGTTGCGGCTAGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014879.3-1408s21c1
Sequence:CCGGTAGCACTGCCATCCAATTTAGCTCGAGCTAAATTGGATGGCAGTGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014879.2-1109s1c1
Sequence:CCGGCCAGCCGTTTAGGGAAATCTTCTCGAGAAGATTTCCCTAAACGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014879.2-1158s1c1
Sequence:CCGGGCTCAGAATGACCTAGACATTCTCGAGAATGTCTAGGTCATTCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014879.2-506s1c1
Sequence:CCGGCGTGCTCTTCTACGTCAACATCTCGAGATGTTGACGTAGAAGAGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014879.2-1410s1c1
Sequence:CCGGCCCATCAGTAATTTCTCTAATCTCGAGATTAGAGAAATTACTGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014879
P2RY14 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 14
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014879.3-1150s21c1
Sequence:CCGGGTATGCTTGGACCCTATTATTCTCGAGAATAATAGGGTCCAAGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014879.3-975s21c1
Sequence:CCGGGAAATCTAGCCGCAACATATTCTCGAGAATATGTTGCGGCTAGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014879.3-1408s21c1
Sequence:CCGGTAGCACTGCCATCCAATTTAGCTCGAGCTAAATTGGATGGCAGTGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014879.2-1109s1c1
Sequence:CCGGCCAGCCGTTTAGGGAAATCTTCTCGAGAAGATTTCCCTAAACGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014879.2-1158s1c1
Sequence:CCGGGCTCAGAATGACCTAGACATTCTCGAGAATGTCTAGGTCATTCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014879.2-506s1c1
Sequence:CCGGCGTGCTCTTCTACGTCAACATCTCGAGATGTTGACGTAGAAGAGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014879.2-1410s1c1
Sequence:CCGGCCCATCAGTAATTTCTCTAATCTCGAGATTAGAGAAATTACTGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014879
P2RY14 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 14
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014879.3-1150s21c1
Sequence:CCGGGTATGCTTGGACCCTATTATTCTCGAGAATAATAGGGTCCAAGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014879.3-975s21c1
Sequence:CCGGGAAATCTAGCCGCAACATATTCTCGAGAATATGTTGCGGCTAGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014879.3-1408s21c1
Sequence:CCGGTAGCACTGCCATCCAATTTAGCTCGAGCTAAATTGGATGGCAGTGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014879.2-1109s1c1
Sequence:CCGGCCAGCCGTTTAGGGAAATCTTCTCGAGAAGATTTCCCTAAACGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014879.2-1158s1c1
Sequence:CCGGGCTCAGAATGACCTAGACATTCTCGAGAATGTCTAGGTCATTCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014879.2-506s1c1
Sequence:CCGGCGTGCTCTTCTACGTCAACATCTCGAGATGTTGACGTAGAAGAGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014879.2-1410s1c1
Sequence:CCGGCCCATCAGTAATTTCTCTAATCTCGAGATTAGAGAAATTACTGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133200
P2RY14 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 14
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133200.3-1417s21c1
Sequence:CCGGCCAAGTATTATCAGTCTTGTTCTCGAGAACAAGACTGATAATACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133200.3-1126s21c1
Sequence:CCGGGCCTTACCACATTGCCAGAATCTCGAGATTCTGGCAATGTGGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133200.3-1282s21c1
Sequence:CCGGCCAGCCATTTAGAGAAGTCTTCTCGAGAAGACTTCTCTAAATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133200.3-731s21c1
Sequence:CCGGAGCTTTGACAGGTACTATAAACTCGAGTTTATAGTACCTGTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133200.2-1125s1c1
Sequence:CCGGGCCTTACCACATTGCCAGAATCTCGAGATTCTGGCAATGTGGTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133200.2-1199s1c1
Sequence:CCGGCCCTGCTCTATGCGAAAGAATCTCGAGATTCTTTCGCATAGAGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133200.2-1281s1c1
Sequence:CCGGCCAGCCATTTAGAGAAGTCTTCTCGAGAAGACTTCTCTAAATGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133200.2-1416s1c1
Sequence:CCGGCCAAGTATTATCAGTCTTGTTCTCGAGAACAAGACTGATAATACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133200
P2RY14 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 14
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133200.3-1417s21c1
Sequence:CCGGCCAAGTATTATCAGTCTTGTTCTCGAGAACAAGACTGATAATACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133200.3-1126s21c1
Sequence:CCGGGCCTTACCACATTGCCAGAATCTCGAGATTCTGGCAATGTGGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133200.3-1282s21c1
Sequence:CCGGCCAGCCATTTAGAGAAGTCTTCTCGAGAAGACTTCTCTAAATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133200.3-731s21c1
Sequence:CCGGAGCTTTGACAGGTACTATAAACTCGAGTTTATAGTACCTGTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133200.2-1125s1c1
Sequence:CCGGGCCTTACCACATTGCCAGAATCTCGAGATTCTGGCAATGTGGTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133200.2-1199s1c1
Sequence:CCGGCCCTGCTCTATGCGAAAGAATCTCGAGATTCTTTCGCATAGAGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133200.2-1281s1c1
Sequence:CCGGCCAGCCATTTAGAGAAGTCTTCTCGAGAAGACTTCTCTAAATGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133200.2-1416s1c1
Sequence:CCGGCCAAGTATTATCAGTCTTGTTCTCGAGAACAAGACTGATAATACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133200
P2RY14 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 14
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133200.3-1417s21c1
Sequence:CCGGCCAAGTATTATCAGTCTTGTTCTCGAGAACAAGACTGATAATACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133200.3-1126s21c1
Sequence:CCGGGCCTTACCACATTGCCAGAATCTCGAGATTCTGGCAATGTGGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133200.3-1282s21c1
Sequence:CCGGCCAGCCATTTAGAGAAGTCTTCTCGAGAAGACTTCTCTAAATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133200.3-731s21c1
Sequence:CCGGAGCTTTGACAGGTACTATAAACTCGAGTTTATAGTACCTGTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133200.2-1125s1c1
Sequence:CCGGGCCTTACCACATTGCCAGAATCTCGAGATTCTGGCAATGTGGTAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133200.2-1199s1c1
Sequence:CCGGCCCTGCTCTATGCGAAAGAATCTCGAGATTCTTTCGCATAGAGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133200.2-1281s1c1
Sequence:CCGGCCAGCCATTTAGAGAAGTCTTCTCGAGAAGACTTCTCTAAATGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133200.2-1416s1c1
Sequence:CCGGCCAAGTATTATCAGTCTTGTTCTCGAGAACAAGACTGATAATACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)